Login to display prices
Login to display prices
DCTN5-dynactin 5 (p25) Gene View larger

DCTN5-dynactin 5 (p25) Gene

PTXBC004191

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCTN5-dynactin 5 (p25) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCTN5-dynactin 5 (p25) Gene

Proteogenix catalog: PTXBC004191
Ncbi symbol: DCTN5
Product name: DCTN5-dynactin 5 (p25) Gene
Size: 2ug
Accessions: BC004191
Gene id: 84516
Gene description: dynactin 5 (p25)
Synonyms: dynactin subunit 5; dynactin 4; dynactin 5 (p25); dynactin subunit p25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttgggcgagctgctctacaacaagtctgagtacatcgagacggcatctgggaacaaagtcagtcgccagtcagtgttgtgtggaagccagaacatcgttctcaatggcaagaccattgtgatgaatgactgtattatccgaggggatctggcaaatgtaagagttggacgtcattgtgttgtgaaaagtcgtagtgtcataaggccaccattcaagaagttcagcaaaggtgttgcattctttcctttacatattggagaccatgtctttattgaggaagattgtgtggtcaacgcagcacagattggttcctatgttcatgttgggaagaactgtgtgattgggcgccgatgtgtgttgaaagactgctgcaaaattcttgacaacacagtattacctccagaaactgtggttccaccattcactgtcttctcaggctgcccaggactcttctcaggggagctcccggagtgcactcaggagctgatgattgacgtcaccaagagctactaccagaagtttttgcccctgacgcaagtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: