Login to display prices
Login to display prices
DOK6-docking protein 6 Gene View larger

DOK6-docking protein 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DOK6-docking protein 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DOK6-docking protein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008583
Product type: DNA & cDNA
Ncbi symbol: DOK6
Origin species: Human
Product name: DOK6-docking protein 6 Gene
Size: 2ug
Accessions: BC008583
Gene id: 220164
Gene description: docking protein 6
Synonyms: DOK5L; HsT3226; docking protein 6; downstream of tyrosine kinase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtgtctggggaccaggctcaatgacatcagccttggggagcccgaccttctggccgcaggagtgcagcgggaacagaatgagagattcaacgtgtatcttatgcctacgccaaacctggatatttatggtgaatgcacaatgcagatcactcatgaaaatatctatctctgggatatccacaatgccaaggtcaaactggtgatgtggcctctcagctcactgaggagatacggtcgggactcaacgtggttcacgtttgagtcaggaagaatgtgtgacacaggagaaggactattcacttttcaaacaagggaaggagaaatgatctatcagaaggttcattctgcgacactggccatagctgagcaacatgaaagattaatgctagaaatggaacagaaggcccggcttcagacaagcttgactgaaccaatgacattatccaaatcaatatctcttcctcgcagcgcgtactggcatcacatcactcgtcagaacagcgttggtgaaatctacagtttgcaaggtcatgggtttggttcgtcaaagatgtctcgtgcacagacatttcccagctacgccccagaacagagtgaagaggcccagcagccgttgtcgcggtccagcagctatggattcagctacagctccagcctcatccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosducin-like 3
- GPN-loop GTPase 3
- SWAP-70 protein
- sorting nexin 19