GPN3-GPN-loop GTPase 3 Gene View larger

GPN3-GPN-loop GTPase 3 Gene

PTXBC008416

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPN3-GPN-loop GTPase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPN3-GPN-loop GTPase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008416
Product type: DNA & cDNA
Ncbi symbol: GPN3
Origin species: Human
Product name: GPN3-GPN-loop GTPase 3 Gene
Size: 2ug
Accessions: BC008416
Gene id: 51184
Gene description: GPN-loop GTPase 3
Synonyms: ATPBD1C; GPN-loop GTPase 3; ATP-binding domain 1 family member C; protein x 0004
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcggtatgcgcagctggtcatgggccccgcgggcagcgggaagagcacctactgtgccaccatggtccagcactgtgaagccctcaaccggtctgtccaagttgtaaacctggatccagcagcagaacacttcaactactccgtgatggctgacatccgggaactgatcgaggtggatgatgtaatggaggatgattctctgcgattcggtcccaacggaggattggtattttgcatggagtactttgccaataattttgactggctggagaactgtcttggccatgtagaggacgactatatcctttttgattgtccaggtcagattgagttgtacactcacctgcctgtgatgaaacagctggtccagcagctcgagcagtgggagttccgagtctgtggagtttttcttgttgattctcagttcatggtggagtcattcaagtttatttctggcatcttggcagccctgagtgccatgatctctctagaaattccgcaagtcaacatcatgacaaaaatggatctgctgagtaaaaaagcaaaaaaggaaattgagaaatttttagatccagacatgtattctttattagaagattctacaagtgacttaagaagcaaaaaattcaagaaactgactaaagctatatgtggactgattgatgactacagcatggttcgatttttaccttacgatcagtcagatgaagaaagcatgaacattgcattgcagcatattgattttgccattcaatatggagaagacctagaatttaaagaaccaaaggaacgtgaagatgagtcttcctctatgtttgacgaatattttcaagaatgccaggatgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SWAP-70 protein
- sorting nexin 19
- sorting nexin 14
- actinin, alpha 4

Buy GPN3-GPN-loop GTPase 3 Gene now

Add to cart