Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PDE4D-phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) Gene
PTXBC008390
New product
Data sheet of PDE4D-phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDE4D-phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDE4D |
| Origin species: | Human |
| Product name: | PDE4D-phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC008390 |
| Gene id: | 5144 |
| Gene description: | phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) |
| Synonyms: | ACRDYS2; DPDE3; HSPDE4D; PDE43; PDE4DN2; STRK1; cAMP-specific 3',5'-cyclic phosphodiesterase 4D; cAMP-specific phosphodiesterase PDE4D6; phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); testicular tissue protein Li 136; phosphodiesterase 4D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagcagacaagcccggacactttaacagtacctgaagtggataatccgcattgtccaaacccgtggctgaacgaagaccttgtgaaatccttgcgagaaaacctgttgcagcatgagaagtccaagacagcgaggaaatcggtttctcccaagctctctccagtgatctctccgagaaattcccccaggcttctgcgcagaatgcttctcagcagcaacatccccaaacagcggcgtttcacggtggcacatacatgttttgatgtggacaatggcacatctgcgggacggagtcccttggatcccatgaccagcccaggatccgggctaattctccaagcaaattttgtccacagtcaacgacgggagtccttcctgtatcgatccgacagcgattatgacctctctccaaagtctatgtcccggaactcctccattgccagtgatatacacggagatgacttgattgtgactccatttgctcaggtcttggccagtctgcgaactgtacgaaacaactttgctgcattaactaatttgcaagatcgagcacctagcaaaagatcacccatgtgcaaccaaccatccatcaacaaagccaccataacaggatcctggatggaattgaacccatatacgttacttgacatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha - matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) - asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) - CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 |