ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene View larger

ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene

PTXBC033730

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033730
Product type: DNA & cDNA
Ncbi symbol: ALG10
Origin species: Human
Product name: ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene
Size: 2ug
Accessions: BC033730
Gene id: 84920
Gene description: asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
Synonyms: ALG10, alpha-1,2-glucosyltransferase; alpha-2-glucosyltransferase ALG10-A; alpha-1,2-glucosyltransferase ALG10-A; ALG10A; DIE2; KCR1; dol-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-Dol alpha-1,2-glucosyltransferase; alpha2-glucosyltransferase; asparagine-linked glycosylation 10 homolog (yeast, alpha-1,2-glucosyltransferase); asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog; asparagine-linked glycosylation protein 10 homolog A; derepression of ITR1 expression 2 homolog; dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase; potassium channel regulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcagctggaaggttactatttctcggccgccttgagctgtacctttttagtatcctgcctcctcttctccgccttcagccgggcgttgcgagagccctacatggacgagatcttccacctgcctcaggcgcagcgctactgtgagggccatttctccctttcccagtgggatcccatgattactacattacctggcttgtacctggtgtcaattggagtgatcaaacctgccatttggatctttggatggtctgaacatgttgtctgctccattgggatgctcagatttgttaatcttctcttcagtgttggcaacttctatttactatatttgcttttctgcaaggtacaacccagaaacaaggctgcctcaagtatccagagagtcttgtcaacattaacactagcagtatttccaacactttatttttttaacttcctttattatacagaagcaggatctatgttttttactctttttgcgtatttgatgtgtctttatggaaatcataaaacttcagccttccttggattttgtggcttcatgtttcggcaaacaaatatcatctgggctgtcttctgtgcaggaaatgtcattgcacaaaagttaacggaggcttggaaaactgagctacaaaagaaggaagacagacttccacctattaaaggaccatttgcagaattcagaaaaattcttcagtttcttttggcttattccatgtcctttaaaaacttgagtatgcttttgcttctgacttggccctacatccttctgggatttctgttttgtgcttttgtagtagttaatggtggaattgttattggcgatcggagtagtcatgaagcctgtcttcattttcctcaactattctactttttttcatttactctctttttttcctttcctcatctcctgtctcctagcaaaattaagacttttctttccttagtttggaaacgtagaattctgttttttgtggttaccttagtctctgtgtttttagtttggaaattcacttatgctcataaatacttgctagcagacaatagacattatactttctatgtgtggaaaagagtttttcaaagatatgaaactgtaaaatatttgttagttccagcctatatatttgctggttggagtatagctgactcattgaaatcaaagtcaattttttggaatttaatgtttttcatatgcttgttcactgttatagttcctcagaaactgctggaatttcgttacttcattttaccttatgtcatttataggcttaacatacctctgcctcccacatccagactcatttgtgaactgagctgctatgcagttgttaatttcataacttttttcatctttctgaacaagacttttcagtggccaaatagtcaggacattcaaaggtttatgtggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
- solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15
- solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

Buy ALG10-asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) Gene now

Add to cart