SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene View larger

SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene

PTXBC002702

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002702
Product type: DNA & cDNA
Ncbi symbol: SLC25A15
Origin species: Human
Product name: SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene
Size: 2ug
Accessions: BC002702
Gene id: 10166
Gene description: solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15
Synonyms: D13S327; HHH; ORC1; ORNT1; mitochondrial ornithine transporter 1; ornithine transporter 1; solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15; solute carrier family 25 member 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatccaatcctgctatccaggctgccattgacctcacagcgggggctgcaggaggtacagcatgtgtactgaccgggcagccctttgacacaatgaaagtgaagatgcagacgttccctgacctgtaccggggcctcaccgactgctgcctgaagacttactcccaggtgggcttccgtggcttctacaagggtaccagtccagcactaatcgccaacatcgctgagaactcagtcctcttcatgtgctacggcttctgccagcaggtggtgcggaaagtggctggattggacaagcaggcaaagctgagtgatctgcagaatgcagccgccggttccttcgcctctgcctttgctgcactggtgctctgccccacggagctcgtgaagtgccggctgcagaccatgtatgagatggagacatcagggaagatagccaagagccagaatacagtgtggtctgtcatcaaaagtattcttaggaaagatggccccttggggttctaccatggactctcaagcactttacttcgagaagtaccaggctatttcttcttcttcggtggctatgaactgagccggtccttttttgcatcagggagatcaaaagatgaattaggccctgtacctttgatgttaagtggtggagttggtgggatttgcctctggcttgcggtatacccagtggattgtatcaaatccagaattcaagttctttccatgtctggaaaacaggcaggatttatcagaacctttttaaatgttgtgaaaaatgaaggaataacggccttatattctggactgaaacctactatgattcgagcattccctgccaatggagcactctttttggcctacgaatatagcaggaagttgatgatgaaccagttggaagcatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
- fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
- phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)

Buy SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene now

Add to cart