SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene View larger

SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006508
Product type: DNA & cDNA
Ncbi symbol: SLC25A11
Origin species: Human
Product name: SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene
Size: 2ug
Accessions: BC006508
Gene id: 8402
Gene description: solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Synonyms: OGC; SLC20A4; mitochondrial 2-oxoglutarate/malate carrier protein; OGCP; solute carrier family 20 (oxoglutarate carrier), member 4; solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11; solute carrier family 25 member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgacggcgagtgccggggccggcgggatagacgggaagccccgtacctcccctaagtccgtcaagttcctgtttgggggcctggccgggatgggagctacagtttttgtccagcccctggacctggtgaagaaccggatgcagttgagcggggaaggggccaagactcgagagtacaaaaccagcttccatgccctcaccagtatcctgaaggcagaaggcctgaggggcatttacactgggctgtcggctggcctgctgcgtcaggccacctacaccactacccgccttggcatctataccgtgctgtttgagcgcctgactggggctgatggtactccccctggctttctgctgaaggctgtgattggcatgaccgcaggtgccactggtgcctttgtgggaacaccagccgaagtggctcttatccgcatgactgccgatggccggcttccagctgaccagcgccgtggctacaaaaatgtgtttaacgccctgattcgaatcacccgggaagagggtgtcctcacactgtggcggggctgcatccctaccatggctcgggccgtcgtcgtcaatgctgcccagctcgcctcctactcccaatccaagcagttcttactggactcaggctacttctctgacaacatcttgtgccacttctgtgccagcatgatcagcggtcttgtcaccactgctgcctccatgcctgtggacattgccaagacccgaatccagaacatgcggatgattgatgggaagccggaatacaagaacgggctggacgtgctgttcaaagttgtccgctacgagggcttcttcagcctgtggaagggcttcacgccgtactatgcccgcctgggcccccacaccgtcctcaccttcatcttcttggagcagatgaacaaggcctacaagcgtctcttcctcagtggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
- fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
- phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta

Buy SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene now

Add to cart