Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NFKBID-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta Gene
PTXBC006273
New product
Data sheet of NFKBID-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFKBID-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006273 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFKBID |
| Origin species: | Human |
| Product name: | NFKBID-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta Gene |
| Size: | 2ug |
| Accessions: | BC006273 |
| Gene id: | 84807 |
| Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta |
| Synonyms: | IkappaBNS; TA-NFKBH; NF-kappa-B inhibitor delta; I-kappa-B-delta; T-cell activation NFKB-like protein; ikB-delta; ikappaBdelta; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta; NFKB inhibitor delta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggtcttgctgtgttgtccaggctggtctgcagctcctggcctcaagtgatcctccttcttcagcttcccaaagtgctaggattacaggcgtgaaccaccgcactccgccaagggagatcaagagcaacaagacagttctgcacttggccgtgcaggctgccaaccccactctggttcagctgctgctggagctgccccggggagacctgcggacctttgtcaacatgaaggcccacgggaacacagccctccacatggcggctgccctgccccctgggccggcccaggaggccatcgtgcggcacctgttggcagctggggcggaccccacactgcgcaacctggagaatgagcagcccgttcacctgctgcggcccgggccgggccctgaggggctccggcagctgttgaagaggagccgtgtggcgccgccaggcctgtcctcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta - antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 - killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A |