No products
Prices are tax excluded
PTXBC006273
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC006273 |
Product type: | DNA & cDNA |
Ncbi symbol: | NFKBID |
Origin species: | Human |
Product name: | NFKBID-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta Gene |
Size: | 2ug |
Accessions: | BC006273 |
Gene id: | 84807 |
Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta |
Synonyms: | IkappaBNS; TA-NFKBH; NF-kappa-B inhibitor delta; I-kappa-B-delta; T-cell activation NFKB-like protein; ikB-delta; ikappaBdelta; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta; NFKB inhibitor delta |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaggtcttgctgtgttgtccaggctggtctgcagctcctggcctcaagtgatcctccttcttcagcttcccaaagtgctaggattacaggcgtgaaccaccgcactccgccaagggagatcaagagcaacaagacagttctgcacttggccgtgcaggctgccaaccccactctggttcagctgctgctggagctgccccggggagacctgcggacctttgtcaacatgaaggcccacgggaacacagccctccacatggcggctgccctgccccctgggccggcccaggaggccatcgtgcggcacctgttggcagctggggcggaccccacactgcgcaacctggagaatgagcagcccgttcacctgctgcggcccgggccgggccctgaggggctccggcagctgttgaagaggagccgtgtggcgccgccaggcctgtcctcttag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta - antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 - killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A |