MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene View larger

MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001875
Product type: DNA & cDNA
Ncbi symbol: MFI2
Origin species: Human
Product name: MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene
Size: 2ug
Accessions: BC001875
Gene id: 4241
Gene description: antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Synonyms: MFI2; CD228; MAP97; MTF1; MTf; antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5; melanoma-associated antigen p97; membrane-bound transferrin-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctccgccgaccactgcgtccagctcatcgcggcccaggaggctgacgccatcactctggatggaggagccatctatgaggcgggaaaggagcacggcctgaagccggtggtgggcgaagtgtacgatcaagaggtcggtacctcctattacgccgtggctgtggtcaggaggagctcccatgtgaccattgacaccctgaaaggcgtgaagtcctgccacacgggcatcaatcgcacagtgggctggaacgtgcccgtgggctacctggtggagagcggccgcctctcggtgatgggctgcgatgtactcaaagctgtcagcgactattttgggggcagctgcgtcccgggggcaggagagaccagttactctgagtccctctgtcgcctctgcaggggtgacagctctggggaaggggtgtgtgacaagagccccctggagagatactacgactacagcggggccttccggtgcctggcggaaggggcaggggacgtggcttttgtgaagcacagcacggtactggagaacacggatgaaagtccatcacgaaggcaaacatggaccagatctgaggaggaagaaggcgagtgccctgcacacgaggaagcacgtaggacgatgcgctctagtgctgggcaagcctggaaatgggctcccgttcacaggccccaggacgagtctgacaaaggagaatttggaaaacgggcaaagagtagggatatgttgggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
- protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
- NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)

Buy MFI2-antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene now

Add to cart