NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene View larger

NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001884
Product type: DNA & cDNA
Ncbi symbol: NDUFS5
Origin species: Human
Product name: NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene
Size: 2ug
Accessions: BC001884
Gene id: 4725
Gene description: NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Synonyms: CI-15k; CI15K; NADH dehydrogenase [ubiquinone] iron-sulfur protein 5; CI-15 kDa; NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase); NADH:ubiquinone oxidoreductase 15 kDa IP subunit; complex I-15 kDa; NADH:ubiquinone oxidoreductase subunit S5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctttcttggacatccagaaaaggttcggccttaacatagatcgatggttgacaatccagagtggtgaacagccctacaagatggctggtcgatgccatgcttttgaaaaagaatggatagaatgtgcacatggaatcggttatactcgggcagagaaagagtgcaagatagaatatgatgatttcgtagagtgtttgcttcggcagaaaacgatgagacgtgcaggtaccatcaggaagcagcgggataagctgataaaggaaggaaagtacacccctccacctcaccacattggcaagggggagcctcggccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
- solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
- leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3

Buy NDUFS5-NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) Gene now

Add to cart