SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene View larger

SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene

PTXBC028721

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028721
Product type: DNA & cDNA
Ncbi symbol: SLC1A6
Origin species: Human
Product name: SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene
Size: 2ug
Accessions: BC028721
Gene id: 6511
Gene description: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: excitatory amino acid transporter 4; sodium-dependent glutamate/aspartate transporter; solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6; solute carrier family 1 member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagccatggcaacagcctgttcctgcgggagagcggccagcggctgggccgggtgggctggctgcagcggctgcaggaaagcctgcagcagagagcactgcgcacgcgcctgcgcctgcagaccatgaccctcgagcacgtgctgcgcttcctgcgccgaaacgccttcattctgctgacggtcagcgccgtggtcattggggtcagcctggcctttgccctgcgcccatatcagctcacctaccgccagatcaagtacttctcttttcctggagagcttctgatgaggatgctgcagatgctggtgttacctctcattgtctccagcctggtcacaggtatggcatccctggacaacaaggccacggggcggatggggatgcgggcagctgtgtactacatggtgaccaccatcatcgcggtcttcatcggcatcctcatggtcaccatcatccatcccgggaagggctccaaggaggggctgcaccgggagggccggatcgagaccatccccacagctgatgccttcatggacctgatcagaaatatgtttccaccaaaccttgtggaggcctgcttcaaacagttcaagacgcagtacagcacgagggtggtaaccaggaccatggtgaggacagagaacgggtctgagccgggtgcctccatgcctcctccattctcagtggagaacggaaccagcttcctggaaaatgtcactcgggccttgggtaccctgcaggagatgctgagctttgaggagactgtacccgtgcctggctccgccaatggcatcaacgccctgggcctcgtggtcttctctgtggcctttgggctggtcattggtggcatgaaacacaagggcagagtcctcagggacttcttcgacagcctcaatgaggctattatgaggctggtgggcatcattatctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3
- carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
- NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
- Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1

Buy SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene now

Add to cart