Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene
PTXBC028721
New product
Data sheet of SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028721 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC1A6 |
| Origin species: | Human |
| Product name: | SLC1A6-solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC028721 |
| Gene id: | 6511 |
| Gene description: | solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 |
| Synonyms: | excitatory amino acid transporter 4; sodium-dependent glutamate/aspartate transporter; solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6; solute carrier family 1 member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcagccatggcaacagcctgttcctgcgggagagcggccagcggctgggccgggtgggctggctgcagcggctgcaggaaagcctgcagcagagagcactgcgcacgcgcctgcgcctgcagaccatgaccctcgagcacgtgctgcgcttcctgcgccgaaacgccttcattctgctgacggtcagcgccgtggtcattggggtcagcctggcctttgccctgcgcccatatcagctcacctaccgccagatcaagtacttctcttttcctggagagcttctgatgaggatgctgcagatgctggtgttacctctcattgtctccagcctggtcacaggtatggcatccctggacaacaaggccacggggcggatggggatgcgggcagctgtgtactacatggtgaccaccatcatcgcggtcttcatcggcatcctcatggtcaccatcatccatcccgggaagggctccaaggaggggctgcaccgggagggccggatcgagaccatccccacagctgatgccttcatggacctgatcagaaatatgtttccaccaaaccttgtggaggcctgcttcaaacagttcaagacgcagtacagcacgagggtggtaaccaggaccatggtgaggacagagaacgggtctgagccgggtgcctccatgcctcctccattctcagtggagaacggaaccagcttcctggaaaatgtcactcgggccttgggtaccctgcaggagatgctgagctttgaggagactgtacccgtgcctggctccgccaatggcatcaacgccctgggcctcgtggtcttctctgtggcctttgggctggtcattggtggcatgaaacacaagggcagagtcctcagggacttcttcgacagcctcaatgaggctattatgaggctggtgggcatcattatctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 - carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) - NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) - Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 |