Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFS7-NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) Gene
PTXBC005954
New product
Data sheet of NDUFS7-NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFS7-NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005954 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFS7 |
| Origin species: | Human |
| Product name: | NDUFS7-NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) Gene |
| Size: | 2ug |
| Accessions: | BC005954 |
| Gene id: | 374291 |
| Gene description: | NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) |
| Synonyms: | CI-20; CI-20KD; MY017; NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial; NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase); NADH-coenzyme Q reductase; NADH-ubiquinone oxidoreductase 20 kDa subunit; NADH:ubiquinone oxidoreductase PSST subunit; PSST subunit; complex I 20kDa subunit; complex I, mitochondrial respiratory chain, 20-KD subunit; complex I-20kD; NADH:ubiquinone oxidoreductase core subunit S7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggtgctgtcagctcctggcctgcgcggcttccggatccttggtctgcgctccagcgtgggcctggctgtgcaggcacgaggtgtccatcagagcgtggccaccgatggcccaagcagcacccagcctgccctgccaaaggccagagccgtggctcccaaacccagcagccggggcgagtatgtggtggccaagctggatgacctcgtcaactgggcccgccggagttctctgtggcccatgaccttcggcctggcctgctgcgccgtggagatgatgcacatggcagcaccccgctacgacatggaccgctttggcgtggtcttccgcgccagcccgcgccagtccgacgtcatgatcgtggccggcacactcaccaacaagatggccccagcgcttcgcaaggtctacgaccagatgccggagccgcgctacgtggtctccatggggagctgcgccaacggaggaggctactaccactattcctactcggtggtgaggggctgcgaccgcatcgtgcccgtggacatctacatcccaggctgcccacctacggccgaggccctgctctacggcatcctgcagctgcagaggaagatcaagcgggagcggaggctgcagatctggtaccgcaggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 - X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) - BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) - STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) |