Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AMMECR1-Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 Gene
PTXBC060813
New product
Data sheet of AMMECR1-Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AMMECR1-Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060813 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AMMECR1 |
| Origin species: | Human |
| Product name: | AMMECR1-Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 Gene |
| Size: | 2ug |
| Accessions: | BC060813 |
| Gene id: | 9949 |
| Gene description: | Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 |
| Synonyms: | AMMERC1; AMME syndrome candidate gene 1 protein; Alport syndrome mental retardation midface hypoplasia and elliptocytosis chromosomal region protein 1; Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgggttgctgcggggtgaagaagcagaaactgtccagttcgcccccctctggctcgggtggcggtggtggcgcctcctcctcctcccactgcagcggagagagccagtgccgagctggggagctgggactaggaggcgccggtacgcggctcaacgggctgggaggtctaaccggaggaggtagcggcagcggctgtaccctctctcccccccagggctgcggcggcggcggcggggggatcgccctgtcgccacctccgagctgcggagtggggaccctactttctaccccggccgccgccacctcttcctcaccctcctcatcgtccgccgcctcgtcctcatcgccgggctcccggaagatggtggtgtcagcagagatgtgctgcttttgcttcgatgtgctctactgtcacctgtatggataccagcagccccggaccccccgattcaccaacgagccctatgcccttaaagatagccgttttcccccaatgacaagggatgagctgccacggcttttctgctcagtgtctctgctcactaactttgaagatgtctgtgattatttggactgggaggtgggtgtacatggcattagaatagaattcatcaatgaaaaaggatcaaaacgcaccgccacctacctaccggaggttgcaaaggagcaaggatgggaccatatacagaccatagactccttattgaggaaaggaggatacaaagctccgattactaatgaattcaggaaaaccataaaactgaccaggtatcgtagtgaaaagatgaccctgagctatgctgaataccttgctcatcgccagcatcatcatttccaaaatggcattgggcatccccttccgccatacaaccattattcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) - BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) - STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) - STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) |