Login to display prices
Login to display prices
XRCC5-X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) Gene View larger

XRCC5-X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) Gene

PTXBC019027

New product

Data sheet of XRCC5-X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC5-X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC019027
Ncbi symbol: XRCC5
Product name: XRCC5-X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) Gene
Size: 2ug
Accessions: BC019027
Gene id: 7520
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Synonyms: DNA repair protein XRCC5; KARP-1; KARP1; KUB2; Ku86; NFIV; X-ray repair cross-complementing protein 5; 86 kDa subunit of Ku antigen; ATP-dependent DNA helicase 2 subunit 2; ATP-dependent DNA helicase II 80 kDa subunit; CTC box-binding factor 85 kDa subunit; CTC85; CTCBF; Ku autoantigen, 80kDa; Ku86 autoantigen related protein 1; TLAA; X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining); lupus Ku autoantigen protein p86; nuclear factor IV; thyroid-lupus autoantigen; X-ray repair cross complementing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggtcggggaataaggcagctgttgtgctgtgtatggacgtgggctttaccatgagtaactccattcctggtatagaatccccatttgaacaagcaaagaaggtgataaccatgtttgtacagcgacaggtgtttgctgagaacaaggatgagattgctttagtcctgtttggtacagatggcactgacaatcccctttctggtggggatcagtatcagaacatcacagtgcacagacatctgatgctaccagattttgatttgctggaggacattgaaagcaaaatccaaccaggttctcaacaggctgacttcctggatgcactaatcgtgagcatggatgtgattcaacatgaaacaataggaaagaagtttgagaagaggcatattgaaatattcactgacctcagcagccgattcagcaaaagtcagctggatattataattcatagcttgaagaaatgtgacatctccctgcaattcttcttgcctttctcacttggcaaggaagatggaagtggggacagaggagatggcccctttcgcttaggtggccatgggccttcctttccactaaaaggaattaccgaacagcaaaaagaaggtcttgagatagtgaaaatggtgatgatatctttagaaggtgaagatgggttggatgaaatttattcattcagtgagagtctgagaaaactgtgcgtcttcaagaaaattgagaggcattccattcactggccctgccgactgaccattggctccaatttgtctataaggattgcagcctataaatcgattctacaggagagagttaaaaagacttggacagttgtggatgcaaaaaccctaaaaaaagaagatatacaaaaagaaacagtttattgcttaaatgatgatgatgaaactgaagttttaaaagaggatattattcaagggttccgctatggaagtgatatagttcctttctctaaagtggatgaggaacaaatgaaatataaatcggaggggaagtgcttctctgttttgggattttgtaaatcttctcaggttcagagaagattcttcatgggaaatcaagttctaaaggtctttgcagcaagagatgatgaggcagctgcagttgcactttcctccctgattcatgctttggatgacttagacatggtggccatagttcgatatgcttatgacaaaagagctaatcctcaagtcggcgtggcttttcctcatatcaagcataactatgagtgtttagtgtatgtgcagctgcctttcatggaagacttgcggcaatacatgttttcatccttgaaaaacagtaagaaatatgctcccaccgaggcacagttgaatgctgttgatgctttgattgactccatgagcttggcaaagaaagatgagaagacagacacccttgaagacttgtttccaaccaccaaaatcccaaatcctcgatttcagagattatttcagtgtctgctgcacagagctttacatccccgggagcctctacccccaattcagcagcatatttggaatatgctgaatcctcccgctgaggtgacaacgaaaagtcagattcctctctctaaaataaagaccctttttcctctgattgaagccaagaaaaaggatcaagtgactgctcaggaaattttccaagacaaccatgaagatggacctacagctaaaaaattaaagactgagcaagggggagcccacttcagcgtctccagtctggctgaaggcagtgtcacctctgttggaagtgtgaatcctgctgaaaacttccgtgttctagtgaaacagaagaaggccagctttgaggaagcgagtaaccagctcataaatcacatcgaacagtttttggatactaatgaaacaccgtattttatgaagagcatagactgcatccgagccttccgggaagaagccattaagttttcagaagagcagcgctttaacaacttcctgaaagcccttcaagagaaagtggaaattaaacaattaaatcatttctgggaaattgttgtccaggatggaattactctgatcaccaaagaggaagcctctggaagttctgtcacagctgaggaagccaaaaagtttctggcccccaaagacaaaccaagtggagacacagcagctgtatttgaagaaggtggtgatgtggacgatttattggacatgatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: