LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene View larger

LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene

PTXBC028208

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028208
Product type: DNA & cDNA
Ncbi symbol: LILRA3
Origin species: Human
Product name: LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene
Size: 2ug
Accessions: BC028208
Gene id: 11026
Gene description: leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3
Synonyms: CD85E; HM31; HM43; ILT-6; ILT6; LIR-4; LIR4; leukocyte immunoglobulin-like receptor subfamily A member 3; CD85 antigen-like family member E; immunoglobulin-like transcript 6; leucocyte Ig-like receptor A3; leukocyte immunoglobulin-like receptor 4; leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3; monocyte inhibitory receptor HM43/HM31; leukocyte immunoglobulin like receptor A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacctccatcctcacggtcctgatctgtctcgggctgagcctggaccccaggacccacgtgcaggcagggcccctccccaagcccaccctctgggctgagccaggctctgtgatcacccaagggagtcctgtgaccctcaggtgtcaggggagcctggagacgcaggagtaccatctatatagagaaaagaaaacagcactctggattacacggatcccacaggagcttgtgaagaagggccagttccccatcctatccatcacctgggaacatgcagggcggtattgctgtatctatggcagccacactgtaggcctctcagagagcagtgaccccctggagctggtggtgacaggagcctacagcaaacccaccctctcagctctgcccagccctgtggtgacctcaggagggaatgtgaccatccagtgtgactcacaggtggcatttgatggcttcattctgtgtaaggaaggagaagatgaacacccacaatgcctgaactcccattcccatgcccgtgggtcatcccgggccatcttctccgtgggccccgtgagcccaagtcgcaggtggtcgtacaggtgctatggttatgactcgcgcgctccctatgtgtggtctctacccagtgatctcctggggctcctggtcccaggtgtttctaagaagccatcactctcagtgcagccgggtcctgtcgtggcccctggggagaagctgaccttccagtgtggctctgatgccggctacgacagatttgttctgtacaaggagtggggacgtgacttcctccagcgccctggccggcagccccaggctgggctctcccaggccaacttcaccctgggccctgtgagccgctcctacgggggccagtacacatgctccggtgcatacaacctctcctccgagtggtcggcccccagcgaccccctggacatcctgatcacaggacagatccgtgccagacccttcctctccgtgcggccgggccccacagtggcctcaggagagaacgtgaccctgctgtgtcagtcacagggagggatgcacactttccttttgaccaaggagggggcagctgattccccgctgcgtctaaaatcaaagcgccaatctcataagtaccaggctgaattccccatgagtcctgtgacctcggcccacgcggggacctacaggtgctacggctcactcagctccaacccctacctgctgactcaccccagtgaccccctggagctcgtggtctcaggagcagctgagaccctcagcccaccacaaaacaagtccgactccaaggctggtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
- NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
- Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
- X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)

Buy LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene now

Add to cart