Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene
PTXBC028208
New product
Data sheet of LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028208 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LILRA3 |
| Origin species: | Human |
| Product name: | LILRA3-leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 Gene |
| Size: | 2ug |
| Accessions: | BC028208 |
| Gene id: | 11026 |
| Gene description: | leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 |
| Synonyms: | CD85E; HM31; HM43; ILT-6; ILT6; LIR-4; LIR4; leukocyte immunoglobulin-like receptor subfamily A member 3; CD85 antigen-like family member E; immunoglobulin-like transcript 6; leucocyte Ig-like receptor A3; leukocyte immunoglobulin-like receptor 4; leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3; monocyte inhibitory receptor HM43/HM31; leukocyte immunoglobulin like receptor A3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacctccatcctcacggtcctgatctgtctcgggctgagcctggaccccaggacccacgtgcaggcagggcccctccccaagcccaccctctgggctgagccaggctctgtgatcacccaagggagtcctgtgaccctcaggtgtcaggggagcctggagacgcaggagtaccatctatatagagaaaagaaaacagcactctggattacacggatcccacaggagcttgtgaagaagggccagttccccatcctatccatcacctgggaacatgcagggcggtattgctgtatctatggcagccacactgtaggcctctcagagagcagtgaccccctggagctggtggtgacaggagcctacagcaaacccaccctctcagctctgcccagccctgtggtgacctcaggagggaatgtgaccatccagtgtgactcacaggtggcatttgatggcttcattctgtgtaaggaaggagaagatgaacacccacaatgcctgaactcccattcccatgcccgtgggtcatcccgggccatcttctccgtgggccccgtgagcccaagtcgcaggtggtcgtacaggtgctatggttatgactcgcgcgctccctatgtgtggtctctacccagtgatctcctggggctcctggtcccaggtgtttctaagaagccatcactctcagtgcagccgggtcctgtcgtggcccctggggagaagctgaccttccagtgtggctctgatgccggctacgacagatttgttctgtacaaggagtggggacgtgacttcctccagcgccctggccggcagccccaggctgggctctcccaggccaacttcaccctgggccctgtgagccgctcctacgggggccagtacacatgctccggtgcatacaacctctcctccgagtggtcggcccccagcgaccccctggacatcctgatcacaggacagatccgtgccagacccttcctctccgtgcggccgggccccacagtggcctcaggagagaacgtgaccctgctgtgtcagtcacagggagggatgcacactttccttttgaccaaggagggggcagctgattccccgctgcgtctaaaatcaaagcgccaatctcataagtaccaggctgaattccccatgagtcctgtgacctcggcccacgcggggacctacaggtgctacggctcactcagctccaacccctacctgctgactcaccccagtgaccccctggagctcgtggtctcaggagcagctgagaccctcagcccaccacaaaacaagtccgactccaaggctggtgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) - NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) - Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 - X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) |