Login to display prices
Login to display prices
CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene View larger

CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

PTXBC014473

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

Proteogenix catalog: PTXBC014473
Ncbi symbol: CEACAM1
Product name: CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene
Size: 2ug
Accessions: BC014473
Gene id: 634
Gene description: carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Synonyms: BGP; BGP1; BGPI; carcinoembryonic antigen-related cell adhesion molecule 1; CD66a antigen; antigen CD66; carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein); carcinoembryonic antigen related cell adhesion molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcacctctcagccccacttcacagagtgcgtgtaccctggcaggggcttctgctcacagcctcacttctaaccttctggaacccgcccaccactgcccagctcactactgaatccatgccattcaatgttgcagaggggaaggaggttcttctccttgtccacaatctgccccagcaactttttggctacagctggtacaaaggggaaagagtggatggcaaccgtcaaattgtaggatatgcaataggaactcaacaagctaccccagggcccgcaaacagcggtcgagagacaatataccccaatgcatccctgctgatccagaacgtcacccagaatgacacaggattctacaccctacaagtcataaagtcagatcttgtgaatgaagaagcaactggacagttccatgtatacccggagctgcccaagccctccatctccagcaacaactccaaccctgtggaggacaaggatgctgtggccttcacctgtgaacctgagactcaggacacaacctacctgtggtggataaacaatcagagcctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctactcagtgtcacaaggaatgacacaggaccctatgagtgtgaaatacagaacccagtgagtgcgaaccgcagtgacccagtcaccttgaatgtcacctatggcccggacacccccaccatttccccttcagacacctattaccgtccaggggcaaacctcagcctctcctgctatgcagcctctaacccacctgcacagtactcctggcttatcaatggaacattccagcaaagcacacaagagctctttatccctaacatcactgtgaataatagtggatcctatacctgccacgccaataactcagtcactggctgcaacaggaccacagtcaagacgatcatagtcactgagctaagtccagtagtagcaaagccccaaatcaaagccagcaagaccacagtcacaggagataaggactctgtgaacctgacctgctccacaaatgacactggaatctccatccgttggttcttcaaaaaccagagtctcccgtcctcggagaggatgaagctgtcccagggcaacaccaccctcagcataaaccctgtcaagagggaggatgctgggacgtattggtgtgaggtcttcaacccaatcagtaagaaccaaagcgaccccatcatgctgaacgtaaactataatgctctaccacaagaaaatggcctctcacctggggccattgctggcattgtgattggagtagtggccctggttgctctgatagcagtagccctggcatgttttctgcatttcgggaagaccggcaggaccactccaatgacccacctaacaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: