Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene
PTXBC014473
New product
Data sheet of CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014473 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEACAM1 |
| Origin species: | Human |
| Product name: | CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene |
| Size: | 2ug |
| Accessions: | BC014473 |
| Gene id: | 634 |
| Gene description: | carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) |
| Synonyms: | BGP; BGP1; BGPI; carcinoembryonic antigen-related cell adhesion molecule 1; CD66a antigen; antigen CD66; carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein); carcinoembryonic antigen related cell adhesion molecule 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcacctctcagccccacttcacagagtgcgtgtaccctggcaggggcttctgctcacagcctcacttctaaccttctggaacccgcccaccactgcccagctcactactgaatccatgccattcaatgttgcagaggggaaggaggttcttctccttgtccacaatctgccccagcaactttttggctacagctggtacaaaggggaaagagtggatggcaaccgtcaaattgtaggatatgcaataggaactcaacaagctaccccagggcccgcaaacagcggtcgagagacaatataccccaatgcatccctgctgatccagaacgtcacccagaatgacacaggattctacaccctacaagtcataaagtcagatcttgtgaatgaagaagcaactggacagttccatgtatacccggagctgcccaagccctccatctccagcaacaactccaaccctgtggaggacaaggatgctgtggccttcacctgtgaacctgagactcaggacacaacctacctgtggtggataaacaatcagagcctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctactcagtgtcacaaggaatgacacaggaccctatgagtgtgaaatacagaacccagtgagtgcgaaccgcagtgacccagtcaccttgaatgtcacctatggcccggacacccccaccatttccccttcagacacctattaccgtccaggggcaaacctcagcctctcctgctatgcagcctctaacccacctgcacagtactcctggcttatcaatggaacattccagcaaagcacacaagagctctttatccctaacatcactgtgaataatagtggatcctatacctgccacgccaataactcagtcactggctgcaacaggaccacagtcaagacgatcatagtcactgagctaagtccagtagtagcaaagccccaaatcaaagccagcaagaccacagtcacaggagataaggactctgtgaacctgacctgctccacaaatgacactggaatctccatccgttggttcttcaaaaaccagagtctcccgtcctcggagaggatgaagctgtcccagggcaacaccaccctcagcataaaccctgtcaagagggaggatgctgggacgtattggtgtgaggtcttcaacccaatcagtaagaaccaaagcgaccccatcatgctgaacgtaaactataatgctctaccacaagaaaatggcctctcacctggggccattgctggcattgtgattggagtagtggccctggttgctctgatagcagtagccctggcatgttttctgcatttcgggaagaccggcaggaccactccaatgacccacctaacaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) - Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 - X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) - BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) |