CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene View larger

CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

PTXBC014473

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014473
Product type: DNA & cDNA
Ncbi symbol: CEACAM1
Origin species: Human
Product name: CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene
Size: 2ug
Accessions: BC014473
Gene id: 634
Gene description: carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Synonyms: BGP; BGP1; BGPI; carcinoembryonic antigen-related cell adhesion molecule 1; CD66a antigen; antigen CD66; carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein); carcinoembryonic antigen related cell adhesion molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcacctctcagccccacttcacagagtgcgtgtaccctggcaggggcttctgctcacagcctcacttctaaccttctggaacccgcccaccactgcccagctcactactgaatccatgccattcaatgttgcagaggggaaggaggttcttctccttgtccacaatctgccccagcaactttttggctacagctggtacaaaggggaaagagtggatggcaaccgtcaaattgtaggatatgcaataggaactcaacaagctaccccagggcccgcaaacagcggtcgagagacaatataccccaatgcatccctgctgatccagaacgtcacccagaatgacacaggattctacaccctacaagtcataaagtcagatcttgtgaatgaagaagcaactggacagttccatgtatacccggagctgcccaagccctccatctccagcaacaactccaaccctgtggaggacaaggatgctgtggccttcacctgtgaacctgagactcaggacacaacctacctgtggtggataaacaatcagagcctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctactcagtgtcacaaggaatgacacaggaccctatgagtgtgaaatacagaacccagtgagtgcgaaccgcagtgacccagtcaccttgaatgtcacctatggcccggacacccccaccatttccccttcagacacctattaccgtccaggggcaaacctcagcctctcctgctatgcagcctctaacccacctgcacagtactcctggcttatcaatggaacattccagcaaagcacacaagagctctttatccctaacatcactgtgaataatagtggatcctatacctgccacgccaataactcagtcactggctgcaacaggaccacagtcaagacgatcatagtcactgagctaagtccagtagtagcaaagccccaaatcaaagccagcaagaccacagtcacaggagataaggactctgtgaacctgacctgctccacaaatgacactggaatctccatccgttggttcttcaaaaaccagagtctcccgtcctcggagaggatgaagctgtcccagggcaacaccaccctcagcataaaccctgtcaagagggaggatgctgggacgtattggtgtgaggtcttcaacccaatcagtaagaaccaaagcgaccccatcatgctgaacgtaaactataatgctctaccacaagaaaatggcctctcacctggggccattgctggcattgtgattggagtagtggccctggttgctctgatagcagtagccctggcatgttttctgcatttcgggaagaccggcaggaccactccaatgacccacctaacaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
- Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
- X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
- BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)

Buy CEACAM1-carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) Gene now

Add to cart