Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene
PTXBC028206
New product
Data sheet of KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028206 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR3DL1 |
| Origin species: | Human |
| Product name: | KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene |
| Size: | 2ug |
| Accessions: | BC028206 |
| Gene id: | 3811 |
| Gene description: | killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 |
| Synonyms: | KIR3DL1/S1; CD158E1; KIR; NKAT-3; NKAT3; NKB1; NKB1B; killer cell immunoglobulin-like receptor 3DL1; CD158 antigen-like family member E; HLA-BW4-specific inhibitory NK cell receptor; KIR antigen 3DL1; killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1; natural killer-associated transcript 3; p70 NK receptor CL-2/CL-11; p70 killer cell inhibitory receptor; p70 natural killer cell receptor clones CL-2/CL-11; killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctcatggtcgtcagcatggcgtgtgttgggttgttcttggtccagagggccggtccacacatgggtggtcaggacaagcccttcctgtctgcctggcccagcgctgtggtgcctcgcggaggacacgtgactcttcggtgtcactatcgtcataggtttaacaatttcatgctatacaaagaagacagaatccacgttcccatcttccatggcagaatattccaggagggcttcaacatgagccctgtgaccacagcacatgcagggaactacacatgtcggggttcacacccacactcccccactgggtggtcggcacccagcaaccccatggtgatcatggtcacaggaaaccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcaggagagagagtcatcctgcaatgttggtcagatatcatgtttgagcacttctttctgcacaaagaggggatctctaaggacccctcacgcctcgttggacagatccatgatggggtctccaaggccaatttctccatcggtcccatgatgcttgcccttgcagggacctacagatgctacggttctgttactcacaccccctatcagttgtcagctcccagtgatcccctggacatcgtggtcacaggtccatatgagaaaccttctctctcagcccagccgggccccaaggttcaggcaggagagagcgtgaccttgtcctgtagctcccggagctcctatgacatgtaccatctatccagggaggggggagcccatgaacgtaggctccctgcagtgcgcaaggtcaacagaacattccaggcagatttccctctgggccctgccacccacggagggacctacagatgcttcggctctttccgtcactctccctacgagtggtcagacccgagtgacccactgcttgtttctgtcacaggaaacccttcaagtagttggccttcacccacagaaccaagctccaaatctggtaaccccagacacctgcacattctgattgggacctcagtggtcatcatcctcttcatcctcctcctcttctttctccttcatctctggtgctccaacaaaaaaaatgctgctgtaatggaccaagagcctgcagggaacagaacagccaacagcgaggactctgatgaacaagaccctgaggaggtgacatacgcacagttggatcactgcgttttcacacagagaaaaatcactcgcccttctcagaggcccaagacaccccctacagataccatcttgtacacggaacttccaaatgctaagcccagatccaaagttgtctcctgcccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A - NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) |