KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene View larger

KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028206
Product type: DNA & cDNA
Ncbi symbol: KIR3DL1
Origin species: Human
Product name: KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene
Size: 2ug
Accessions: BC028206
Gene id: 3811
Gene description: killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Synonyms: KIR3DL1/S1; CD158E1; KIR; NKAT-3; NKAT3; NKB1; NKB1B; killer cell immunoglobulin-like receptor 3DL1; CD158 antigen-like family member E; HLA-BW4-specific inhibitory NK cell receptor; KIR antigen 3DL1; killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1; natural killer-associated transcript 3; p70 NK receptor CL-2/CL-11; p70 killer cell inhibitory receptor; p70 natural killer cell receptor clones CL-2/CL-11; killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgctcatggtcgtcagcatggcgtgtgttgggttgttcttggtccagagggccggtccacacatgggtggtcaggacaagcccttcctgtctgcctggcccagcgctgtggtgcctcgcggaggacacgtgactcttcggtgtcactatcgtcataggtttaacaatttcatgctatacaaagaagacagaatccacgttcccatcttccatggcagaatattccaggagggcttcaacatgagccctgtgaccacagcacatgcagggaactacacatgtcggggttcacacccacactcccccactgggtggtcggcacccagcaaccccatggtgatcatggtcacaggaaaccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcaggagagagagtcatcctgcaatgttggtcagatatcatgtttgagcacttctttctgcacaaagaggggatctctaaggacccctcacgcctcgttggacagatccatgatggggtctccaaggccaatttctccatcggtcccatgatgcttgcccttgcagggacctacagatgctacggttctgttactcacaccccctatcagttgtcagctcccagtgatcccctggacatcgtggtcacaggtccatatgagaaaccttctctctcagcccagccgggccccaaggttcaggcaggagagagcgtgaccttgtcctgtagctcccggagctcctatgacatgtaccatctatccagggaggggggagcccatgaacgtaggctccctgcagtgcgcaaggtcaacagaacattccaggcagatttccctctgggccctgccacccacggagggacctacagatgcttcggctctttccgtcactctccctacgagtggtcagacccgagtgacccactgcttgtttctgtcacaggaaacccttcaagtagttggccttcacccacagaaccaagctccaaatctggtaaccccagacacctgcacattctgattgggacctcagtggtcatcatcctcttcatcctcctcctcttctttctccttcatctctggtgctccaacaaaaaaaatgctgctgtaatggaccaagagcctgcagggaacagaacagccaacagcgaggactctgatgaacaagaccctgaggaggtgacatacgcacagttggatcactgcgttttcacacagagaaaaatcactcgcccttctcagaggcccaagacaccccctacagataccatcttgtacacggaacttccaaatgctaagcccagatccaaagttgtctcctgcccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
- NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)

Buy KIR3DL1-killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 Gene now

Add to cart