PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene View larger

PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010353
Product type: DNA & cDNA
Ncbi symbol: PTPLA
Origin species: Human
Product name: PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene
Size: 2ug
Accessions: BC010353
Gene id: 9200
Gene description: protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Synonyms: PTPLA; CAP; very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 1; cementum attachment protein; protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A; very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase 1; 3-hydroxyacyl-CoA dehydratase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcgcctgacggaagcggcggcagcgggcagcggctctcgggctgcaggctgggcagggtcccctcccacgctcctgccgctgtctcccacgtcccccaggtgcgcggccaccatggcgtccagcgacgaggacggcaccaacggcggcgcctcggaggccggcgaggaccgggaggctcccggcaagcggaggcgcctggggttcttggccaccgcctggctcaccttctacgacatcgccatgaccgcggggtggttggttctagctattgccatggtacgtttttatatggaaaaaggaacacacagaggtttatataaaagtattcagaagacacttaaatttttccagacatttgccttgcttgagatagttcactgtttaattggaattgtacctacttctgtgattgtgactggggtccaagtgagttcaagaatctttatggtgtggctcattactcacagtataaaaccaatccagaatgaagagagtgtggtgctttttctggtcgcgtggactgtgacagagatcactcgctattccttctacacattcagccttcttgaccacttgccatacttcattaaatgggccagatataatttttttatcatcttatatcctgttggagttgctggtgaacttcttacaatatacgctgccttgccgcatgtgaagaaaacaggaatgttttcaataagacttcctaacaaatacaatgtctcttttgactactattattttcttcttataaccatggcatcatatatacctttgtttccacaactctattttcatatgttacgtcaaagaagaaaggtgcttcatggagaggtgattgtagaaaaggatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
- solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6

Buy PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene now

Add to cart