Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene
PTXBC015528
New product
Data sheet of NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015528 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFKBIB |
| Origin species: | Human |
| Product name: | NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene |
| Size: | 2ug |
| Accessions: | BC015528 |
| Gene id: | 4793 |
| Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta |
| Synonyms: | IKBB; TRIP9; NF-kappa-B inhibitor beta; I-kappa-B-beta; NF-kappa-BIB; TR-interacting protein 9; TRIP-9; ikB-B; ikB-beta; ikappaBbeta; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta; thyroid receptor-interacting protein 9; NFKB inhibitor beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctggggtcgcgtgcttgggaaaagctgccgacgcagatgaatggtgcgacagcggcctgggctccctgggtccggacgcagcggcccccggaggacctgggttgggcgcggagttgggcccggggctgtcgtgggctcccctcgtcttcggctacgtcactgaggatggggacacggcactgcacttggctgtgattcatcagcatgaacccttcctggattttcttctaggcttctcggccggcactgagtacatggacctgcagaatgacctaggccagacagccctgcacctggcagccatcctgggggagacatccacggtggagaagctgtacgcagcaggcgccgggctgtgtgtggcggagcgtaggggccacacggcgctgcacctggcctgccgtgtgggggcacacgcctgtgcccgtgccctgcttcagccccgcccccggcgccccagggaagcccccgacacctacctcgctcagggccctgaccgtactcccgacaccaaccatacccctgtcgccttgtaccccgattccgacttggagaaggaagaagaggagagtgaggaggactggaagctgcagctggaggctgaaaactacgagggccacaccccactccacgtggccgttatccacaaagatgtggagatggtccggctgctccgagatgctggagctgaccttgacaaaccggagcccacgtgcggccggagcccccttcatttggcagtggaggcccaggcagccgatgtgctggagcttctcctgagggcaggcgcgaaccctgctgcccgcatgtacggtggccgcaccccactcggcagtgccatgctccggcccaaccccatcctcgcccgcctcctccgtgcacacggagcccctgagcccgagggcgaggacgagaaatccggcccctgcagcagcagtagcgacagcgacagcggagacgagggcgatgaatacgacgacattgtggttcacagcagccgcagccaaacccggctgcctcccaccccagcctcaaaacctcttcctgacgacccccgccccgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 - killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A - NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) |