NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene View larger

NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene

PTXBC015528

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015528
Product type: DNA & cDNA
Ncbi symbol: NFKBIB
Origin species: Human
Product name: NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene
Size: 2ug
Accessions: BC015528
Gene id: 4793
Gene description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Synonyms: IKBB; TRIP9; NF-kappa-B inhibitor beta; I-kappa-B-beta; NF-kappa-BIB; TR-interacting protein 9; TRIP-9; ikB-B; ikB-beta; ikappaBbeta; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta; thyroid receptor-interacting protein 9; NFKB inhibitor beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggggtcgcgtgcttgggaaaagctgccgacgcagatgaatggtgcgacagcggcctgggctccctgggtccggacgcagcggcccccggaggacctgggttgggcgcggagttgggcccggggctgtcgtgggctcccctcgtcttcggctacgtcactgaggatggggacacggcactgcacttggctgtgattcatcagcatgaacccttcctggattttcttctaggcttctcggccggcactgagtacatggacctgcagaatgacctaggccagacagccctgcacctggcagccatcctgggggagacatccacggtggagaagctgtacgcagcaggcgccgggctgtgtgtggcggagcgtaggggccacacggcgctgcacctggcctgccgtgtgggggcacacgcctgtgcccgtgccctgcttcagccccgcccccggcgccccagggaagcccccgacacctacctcgctcagggccctgaccgtactcccgacaccaaccatacccctgtcgccttgtaccccgattccgacttggagaaggaagaagaggagagtgaggaggactggaagctgcagctggaggctgaaaactacgagggccacaccccactccacgtggccgttatccacaaagatgtggagatggtccggctgctccgagatgctggagctgaccttgacaaaccggagcccacgtgcggccggagcccccttcatttggcagtggaggcccaggcagccgatgtgctggagcttctcctgagggcaggcgcgaaccctgctgcccgcatgtacggtggccgcaccccactcggcagtgccatgctccggcccaaccccatcctcgcccgcctcctccgtgcacacggagcccctgagcccgagggcgaggacgagaaatccggcccctgcagcagcagtagcgacagcgacagcggagacgagggcgatgaatacgacgacattgtggttcacagcagccgcagccaaacccggctgcctcccaccccagcctcaaaacctcttcctgacgacccccgccccgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
- killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
- protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
- NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)

Buy NFKBIB-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene now

Add to cart