No products
Prices are tax excluded
PTXBC004983
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004983 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFKBIA |
| Origin species: | Human |
| Product name: | NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene |
| Size: | 2ug |
| Accessions: | BC004983 |
| Gene id: | 4792 |
| Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha |
| Synonyms: | IKBA; MAD-3; NFKBI; NF-kappa-B inhibitor alpha; I-kappa-B-alpha; ikB-alpha; major histocompatibility complex enhancer-binding protein MAD3; nuclear factor of kappa light chain gene enhancer in B-cells; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; NFKB inhibitor alpha |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggtgccgcgcggctcggagccctggaagcagcagctcaccgaggacggggactcgttcctgcacttggccatcatccatgaagaaaaggcactgaccatggaagtgatccgccaggtgaagggagacctggctttcctcaacttccagaacaacctgcagcagactccactccacttggctgtgatcaccaaccagccagaaattgctgaggcacttctgggagctggctgtgatcctgagctccgagactttcgaggaaatacccccctacaccttgcctgtgagcagggctgcctggccagcgtgggagtcctgactcagtcctgcaccaccccgcacctccactccatcctgaaggctaccaactacaatggccacacgtgtctacacttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctgatgtcaatgctcaggagccctgtaatggccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgttgaagtgtggggctgatgtcaacagagttacctaccagggctattctccctaccagctcacctggggccgcccaagcacccggatacagcagcagctgggccagctgacactagaaaaccttcagatgctgccagagagtgaggatgaggagagctatgacacagagtcagagttcacggagttcacagaggacgagctgccctatgatgactgtgtgtttggaggccagcgtctgacgttatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus) - phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta |