Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene
PTXBC012977
New product
Data sheet of CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012977 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTDSP1 |
| Origin species: | Human |
| Product name: | CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene |
| Size: | 2ug |
| Accessions: | BC012977 |
| Gene id: | 58190 |
| Gene description: | CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 |
| Synonyms: | NIF3; NLI-IF; NLIIF; SCP1; carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1; CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1; NLI-interacting factor 3; nuclear LIM interactor-interacting factor 3; small C-terminal domain phosphatase 1; CTD small phosphatase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagctcggccgtcattactcagatcagcaaggaggaggctcggggcccgctgcggggcaaaggtgaccagaagtcagcagcttcccagaagccccgaagccggggcatcctccactcactcttctgctgtgtctgccgggatgatggggaggccctgcctgctcacagcggggcgcccctgcttgtggaggagaatggagccatccctaagcagaccccagtccaatacctgctccctgaggccaaggcccaggactcagacaagatctgcgtggtcatcgacctggacgagaccctggtgcacagctccttcaagccagtgaacaacgcggacttcatcatccctgtggagattgatggggtggtccaccaggtctacgtgttgaagcgtcctcacgtggatgagttcctgcagcgaatgggcgagctctttgaatgtgtgctgttcactgctagcctcgccaagtacgcagacccagtagctgacctgctggacaaatggggggccttccgggcccggctgtttcgagagtcctgcgtcttccaccgggggaactacgtgaaggacctgagccggttgggtcgagacctgcggcgggtgctcatcctggacaattcacctgcctcctatgtcttccatccagacaatgctgtaccggtggcctcgtggtttgacaacatgagtgacacagagctccacgacctcctccccttcttcgagcaactcagccgtgtggacgacgtgtactcagtgctcaggcagccacggccagggagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 - solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha - fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus) |