CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene View larger

CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012977
Product type: DNA & cDNA
Ncbi symbol: CTDSP1
Origin species: Human
Product name: CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene
Size: 2ug
Accessions: BC012977
Gene id: 58190
Gene description: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Synonyms: NIF3; NLI-IF; NLIIF; SCP1; carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1; CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1; NLI-interacting factor 3; nuclear LIM interactor-interacting factor 3; small C-terminal domain phosphatase 1; CTD small phosphatase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagctcggccgtcattactcagatcagcaaggaggaggctcggggcccgctgcggggcaaaggtgaccagaagtcagcagcttcccagaagccccgaagccggggcatcctccactcactcttctgctgtgtctgccgggatgatggggaggccctgcctgctcacagcggggcgcccctgcttgtggaggagaatggagccatccctaagcagaccccagtccaatacctgctccctgaggccaaggcccaggactcagacaagatctgcgtggtcatcgacctggacgagaccctggtgcacagctccttcaagccagtgaacaacgcggacttcatcatccctgtggagattgatggggtggtccaccaggtctacgtgttgaagcgtcctcacgtggatgagttcctgcagcgaatgggcgagctctttgaatgtgtgctgttcactgctagcctcgccaagtacgcagacccagtagctgacctgctggacaaatggggggccttccgggcccggctgtttcgagagtcctgcgtcttccaccgggggaactacgtgaaggacctgagccggttgggtcgagacctgcggcgggtgctcatcctggacaattcacctgcctcctatgtcttccatccagacaatgctgtaccggtggcctcgtggtttgacaacatgagtgacacagagctccacgacctcctccccttcttcgagcaactcagccgtgtggacgacgtgtactcagtgctcaggcagccacggccagggagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15
- solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
- fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)

Buy CTDSP1-CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene now

Add to cart