NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene View larger

NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002601
Product type: DNA & cDNA
Ncbi symbol: NFKBIA
Origin species: Human
Product name: NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene
Size: 2ug
Accessions: BC002601
Gene id: 4792
Gene description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Synonyms: IKBA; MAD-3; NFKBI; NF-kappa-B inhibitor alpha; I-kappa-B-alpha; ikB-alpha; major histocompatibility complex enhancer-binding protein MAD3; nuclear factor of kappa light chain gene enhancer in B-cells; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; NFKB inhibitor alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggtgccgcgcggctcggagccctggaagcagcagctcaccgaggacggggactcgttcctgcacttggccatcatccatgaagaaaaggcactgaccatggaagtgatccgccaggtgaagggagacctggccttcctcaacttccagaacaacctgcagcagactccactccacttggctgtgatcaccaaccagccagaaattgctgaggcacttctgggagctggctgtgatcctgagctccgagactttcgaggaaatacccccctacaccttgcctgtgagcagggctgcctggccagcgtgggagtcctgactcagtcctgcaccaccccgcacctccactccatcctgaaggctaccaactacaatggccacacgtgtctacacttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctgatgtcaatgctcaggagccctgtaatggccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgttgaagtgtggggctgatgtcaacagagttacctaccagggctattctccctaccagctcacctggggccgcccaagcacccggatacagcagcagctgggccagctgacactagaaaaccttcagatgctgccagagagtgaggatgaggagagctatgacacagagtcagagttcacggagttcacagaggacgagctgccctatgatgactgtgtgtttggaggccagcgtctgacgttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
- asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
- CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
- solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15

Buy NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene now

Add to cart