TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene View larger

TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene

PTXBC029848

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029848
Product type: DNA & cDNA
Ncbi symbol: TNFRSF14
Origin species: Human
Product name: TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene
Size: 2ug
Accessions: BC029848
Gene id: 8764
Gene description: tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Synonyms: ATAR; CD270; HVEA; HVEM; LIGHTR; TR2; tumor necrosis factor receptor superfamily member 14; CD40-like protein; herpes virus entry mediator A; tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator); tumor necrosis factor receptor-like gene2; TNF receptor superfamily member 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtcccggcctccacgtacccctctcagcccctcctcttggactccagccatgggcctgcgcgcgagccggaactgctccaggacagagaacgccgtgtgtggctgcagcccaggccacttctgcatcgtccaggacggggaccaccgcgccgcgtgccgcgcttacgccacctccagcccgggccagagggtgcagaagggaggcaccgagagtcaggacaccctgtgtcagaactgccccccggggaccttctctcccaatgggaccctggaggaatgtcagcaccagaccaagtgcagctggctggtgacgaaggccggagctgggaccagcagctcccactgggtatggtggtttctctcagggagcctcgtcatcgtcattgtttgctccacagttggcctaatcatatgtgtgaaaagaagaaagccaaggggtgatgtagtcaaggtgatcgtctccgtccagcggaaaagacaggaggcagaaggtgaggccacagtcattgaggccctgcaggcccctccggacgtcaccacggtggccgtggaggagacaataccctcattcacggggaggagcccaaaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
- interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
- phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

Buy TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene now

Add to cart