Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene
PTXBC029848
New product
Data sheet of TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029848 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF14 |
| Origin species: | Human |
| Product name: | TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene |
| Size: | 2ug |
| Accessions: | BC029848 |
| Gene id: | 8764 |
| Gene description: | tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) |
| Synonyms: | ATAR; CD270; HVEA; HVEM; LIGHTR; TR2; tumor necrosis factor receptor superfamily member 14; CD40-like protein; herpes virus entry mediator A; tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator); tumor necrosis factor receptor-like gene2; TNF receptor superfamily member 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgtcccggcctccacgtacccctctcagcccctcctcttggactccagccatgggcctgcgcgcgagccggaactgctccaggacagagaacgccgtgtgtggctgcagcccaggccacttctgcatcgtccaggacggggaccaccgcgccgcgtgccgcgcttacgccacctccagcccgggccagagggtgcagaagggaggcaccgagagtcaggacaccctgtgtcagaactgccccccggggaccttctctcccaatgggaccctggaggaatgtcagcaccagaccaagtgcagctggctggtgacgaaggccggagctgggaccagcagctcccactgggtatggtggtttctctcagggagcctcgtcatcgtcattgtttgctccacagttggcctaatcatatgtgtgaaaagaagaaagccaaggggtgatgtagtcaaggtgatcgtctccgtccagcggaaaagacaggaggcagaaggtgaggccacagtcattgaggccctgcaggcccctccggacgtcaccacggtggccgtggaggagacaataccctcattcacggggaggagcccaaaccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) - interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) - phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha |