Login to display prices
Login to display prices
TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene View larger

TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene

Proteogenix catalog: PTXBC029848
Ncbi symbol: TNFRSF14
Product name: TNFRSF14-tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) Gene
Size: 2ug
Accessions: BC029848
Gene id: 8764
Gene description: tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Synonyms: ATAR; CD270; HVEA; HVEM; LIGHTR; TR2; tumor necrosis factor receptor superfamily member 14; CD40-like protein; herpes virus entry mediator A; tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator); tumor necrosis factor receptor-like gene2; TNF receptor superfamily member 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtcccggcctccacgtacccctctcagcccctcctcttggactccagccatgggcctgcgcgcgagccggaactgctccaggacagagaacgccgtgtgtggctgcagcccaggccacttctgcatcgtccaggacggggaccaccgcgccgcgtgccgcgcttacgccacctccagcccgggccagagggtgcagaagggaggcaccgagagtcaggacaccctgtgtcagaactgccccccggggaccttctctcccaatgggaccctggaggaatgtcagcaccagaccaagtgcagctggctggtgacgaaggccggagctgggaccagcagctcccactgggtatggtggtttctctcagggagcctcgtcatcgtcattgtttgctccacagttggcctaatcatatgtgtgaaaagaagaaagccaaggggtgatgtagtcaaggtgatcgtctccgtccagcggaaaagacaggaggcagaaggtgaggccacagtcattgaggccctgcaggcccctccggacgtcaccacggtggccgtggaggagacaataccctcattcacggggaggagcccaaaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice