Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene
PTXBC008346
New product
Data sheet of ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008346 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERCC2 |
| Origin species: | Human |
| Product name: | ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene |
| Size: | 2ug |
| Accessions: | BC008346 |
| Gene id: | 2068 |
| Gene description: | excision repair cross-complementing rodent repair deficiency, complementation group 2 |
| Synonyms: | COFS2; EM9; TFIIH; TTD; TTD1; XPD; TFIIH basal transcription factor complex helicase XPD subunit; BTF2 p80; CXPD; DNA excision repair protein ERCC-2; DNA repair protein complementing XP-D cells; TFIIH 80 kDa subunit; TFIIH basal transcription factor complex 80 kDa subunit; TFIIH basal transcription factor complex helicase XPB subunit; TFIIH basal transcription factor complex helicase subunit; TFIIH p80; basic transcription factor 2 80 kDa subunit; excision repair cross-complementation group 2; excision repair cross-complementing rodent repair deficiency, complementation group 2; xeroderma pigmentosum complementary group D; xeroderma pigmentosum group D-complementing protein; ERCC excision repair 2, TFIIH core complex helicase subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggagctcaaacgcacgctggacgccaagggtcatggagtcctggagatgccctcaggcaccgggaagacagtatccctgttggccctgatcatggcataccagagagcatatccgctggaggtgaccaaactcatctactgctcaagaactgtgccagagattgagaaggtgattgaagagcttcgaaagttgctcaacttctatgagaagcaggagggcgagaagctgccgtttctgggactggctctgagctcccgcaaaaacttgtgtattcaccctgaggtgacacccctgcgctttgggaaggacgtcgatgggaaatgccacagcctcacagcctcctatgtgcgggcgcagtaccagcatgacaccagcctgccccactgccgattctatgaggaatttgatgcccatgggcgtgaggtgcccctccccgctggcatctacaacctggatgacctgaaggccctggggcggcgccagggctggtgcccatacttccttgctcgatactcaatcctgcatgccaatgtggtggtttatagctaccactacctcctggaccccaagattgcagacctggtgtccaaggaactggcccgcaaggccgtcgtggtcttcgacgaggcccacaacattgacaacgtctgcatcgactccatgagcgtcaacctcacccgccggacccttgaccggtgccagggcaacctggagaccctgcagaagacggtgctcaggatcaaagagacagacgagcagcgcctgcgggacgagtaccggcgtctggtggaggggctgcgggaggccagcgccgcccgggagacggacgcccacctggccaaccccgtgctgcccgacgaagtgctgcaggaggcagtgcctggctccatccgcacggccgagcatttcctgggcttcctgaggcggctgctggagtacgtgaagtggcggctgcgtgtgcagcatgtggtgcaggagagcccgcccgccttcctgagcggcctggcccagcgcgtgtgcatccagcgcaagcccctcagattctgtgctgaacgcctccggtccctgctgcatactctggagatcaccgaccttgctgacttctccccgctcaccctccttgctaactttgccacccttgtcagcacctacgccaaaggccaggctcagcactgtggaagcagcaggaaccaaaaaagatctcatccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein - butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1 - tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) - prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) |