Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene
PTXBC038104
New product
Data sheet of RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038104 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCBTB1 |
| Origin species: | Human |
| Product name: | RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC038104 |
| Gene id: | 55213 |
| Gene description: | regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 |
| Synonyms: | CLLD7; CLLL7; GLP; RDEOA; RCC1 and BTB domain-containing protein 1; CLL deletion region gene 7 protein; GDP/GTP exchange factor (GEF)-like protein; chronic lymphocytic leukemia deletion region gene 7 protein; regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1; regulator of chromosome condensation and BTB domain-containing protein 1; RCC1 and BTB domain containing protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggatgtcggaaagtggcccatcttcactctactctcccctcaagagatcgcgtctattcggaaggtgtgtgtcttcggcacctcagccagtgaagcactgtacgttactgacaatgatgaggtctttgtatttggactgaactatagtaactgtctaggaactggagataaccagagtacacttgtacccaaaaagctagaaggcttatgtggaaagaagattaaaagcctcagttacgggagtggaccacatgttcttctcagcaccgaagatggagtggtttatgcctggggccacaatggatatagccagcttgggaatgggacgaccaaccaaggcattgctaccgtccaggtctgtaccaatctcttgatcaagcaagtggtggaagtagcttgtggctcacatcattcaatggctctggcagctgatggagaggtgtttgcttggggttataacaactgtggccaagtgggatcaggttctacagcaaatcaaccaactcctcgaaaagttacaaactgtttacatattaagagggtagttggcattgcctgtggtcagacttcatccatggctgttctggacaatggcgaggtatatggctggggttacaatggcaacggtcagctgggcttgggaaacaatggcaaccagctgacccctgtgagagtggcagctttgcacagcgtgtgtgtgaaccagattgtctgcggttacgcacatactctagcactaacagatgagggcttgctgtatgcctggggagctaacacatatgggcagctgggaactggcaataaaaataacctgctaagcccagcacacatcatggtggagaaagaaagggtggtagagattgcagcctgtcactctgcccacacgtctgcagccaagacgcagggtgggcacgtgtacatgtggggccagtgccggggtcagtccgtgatcctcccgcacctcacccacttctcctgcaccgacgacgtgtttgcctgctttgccactccggccgtctcgtggcgcctcctgtctgtggtgagtattgtgattggaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 - ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) - excision repair cross-complementing rodent repair deficiency, complementation group 2 - amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein |