Login to display prices
Login to display prices
RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene View larger

RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038104
Product type: DNA & cDNA
Ncbi symbol: RCBTB1
Origin species: Human
Product name: RCBTB1-regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene
Size: 2ug
Accessions: BC038104
Gene id: 55213
Gene description: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: CLLD7; CLLL7; GLP; RDEOA; RCC1 and BTB domain-containing protein 1; CLL deletion region gene 7 protein; GDP/GTP exchange factor (GEF)-like protein; chronic lymphocytic leukemia deletion region gene 7 protein; regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1; regulator of chromosome condensation and BTB domain-containing protein 1; RCC1 and BTB domain containing protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggatgtcggaaagtggcccatcttcactctactctcccctcaagagatcgcgtctattcggaaggtgtgtgtcttcggcacctcagccagtgaagcactgtacgttactgacaatgatgaggtctttgtatttggactgaactatagtaactgtctaggaactggagataaccagagtacacttgtacccaaaaagctagaaggcttatgtggaaagaagattaaaagcctcagttacgggagtggaccacatgttcttctcagcaccgaagatggagtggtttatgcctggggccacaatggatatagccagcttgggaatgggacgaccaaccaaggcattgctaccgtccaggtctgtaccaatctcttgatcaagcaagtggtggaagtagcttgtggctcacatcattcaatggctctggcagctgatggagaggtgtttgcttggggttataacaactgtggccaagtgggatcaggttctacagcaaatcaaccaactcctcgaaaagttacaaactgtttacatattaagagggtagttggcattgcctgtggtcagacttcatccatggctgttctggacaatggcgaggtatatggctggggttacaatggcaacggtcagctgggcttgggaaacaatggcaaccagctgacccctgtgagagtggcagctttgcacagcgtgtgtgtgaaccagattgtctgcggttacgcacatactctagcactaacagatgagggcttgctgtatgcctggggagctaacacatatgggcagctgggaactggcaataaaaataacctgctaagcccagcacacatcatggtggagaaagaaagggtggtagagattgcagcctgtcactctgcccacacgtctgcagccaagacgcagggtgggcacgtgtacatgtggggccagtgccggggtcagtccgtgatcctcccgcacctcacccacttctcctgcaccgacgacgtgtttgcctgctttgccactccggccgtctcgtggcgcctcctgtctgtggtgagtattgtgattggaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
- ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
- excision repair cross-complementing rodent repair deficiency, complementation group 2
- amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein