MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene View larger

MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene

PTXBC000229

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000229
Product type: DNA & cDNA
Ncbi symbol: MIS12
Origin species: Human
Product name: MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene
Size: 2ug
Accessions: BC000229
Gene id: 79003
Gene description: MIS12, MIND kinetochore complex component, homolog (yeast)
Synonyms: MIS12, kinetochore complex component; homolog of yeast Mis12; MIS12, MIND kinetochore complex component, homolog; MIS12 homolog; protein MIS12 homolog; 2510025F08Rik; KNTC2AP; MTW1; hMis12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtggatccaatgacctacgaggcccagttctttggcttcacgccacaaacgtgcatgcttcggatctacattgcatttcaagactacctatttgaagtgatgcaggccgttgaacaggttattctgaagaagctggatggcatcccagactgtgacattagcccagtgcagattcgcaaatgcacagagaagtttctttgcttcatgaaaggacattttgataacctttttagcaaaatggagcaactgtttttgcagctgattttacgtattccctcaaacatcttgcttcctgaagataaatgtaaggagacaccttatagtgaggaagattttcagcatctccagaaagaaattgaacagttacaggagaagtacaagactgaattatgtactaagcaggcccttcttgcagaattagaagagcaaaaaattgttcaggccaaactcaaacagacgttgactttctttgatgagcttcataatgttggcagagatcatgggactagtgattttagggagagtttagtatccctggttcagaactccagaaaactacagaacattagagacaatgtggaaaaggaatcgaaacgactgaaaatatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
- v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
- polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
- protein phosphatase 1, regulatory (inhibitor) subunit 3C

Buy MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene now

Add to cart