Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene
PTXBC000229
New product
Data sheet of MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000229 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MIS12 |
| Origin species: | Human |
| Product name: | MIS12-MIS12, MIND kinetochore complex component, homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000229 |
| Gene id: | 79003 |
| Gene description: | MIS12, MIND kinetochore complex component, homolog (yeast) |
| Synonyms: | MIS12, kinetochore complex component; homolog of yeast Mis12; MIS12, MIND kinetochore complex component, homolog; MIS12 homolog; protein MIS12 homolog; 2510025F08Rik; KNTC2AP; MTW1; hMis12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgtggatccaatgacctacgaggcccagttctttggcttcacgccacaaacgtgcatgcttcggatctacattgcatttcaagactacctatttgaagtgatgcaggccgttgaacaggttattctgaagaagctggatggcatcccagactgtgacattagcccagtgcagattcgcaaatgcacagagaagtttctttgcttcatgaaaggacattttgataacctttttagcaaaatggagcaactgtttttgcagctgattttacgtattccctcaaacatcttgcttcctgaagataaatgtaaggagacaccttatagtgaggaagattttcagcatctccagaaagaaattgaacagttacaggagaagtacaagactgaattatgtactaagcaggcccttcttgcagaattagaagagcaaaaaattgttcaggccaaactcaaacagacgttgactttctttgatgagcttcataatgttggcagagatcatgggactagtgattttagggagagtttagtatccctggttcagaactccagaaaactacagaacattagagacaatgtggaaaaggaatcgaaacgactgaaaatatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 - v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) - polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa - protein phosphatase 1, regulatory (inhibitor) subunit 3C |