Login to display prices
Login to display prices
ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene View larger

ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

PTXBC017314

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

Proteogenix catalog: PTXBC017314
Ncbi symbol: ETS1
Product name: ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene
Size: 2ug
Accessions: BC017314
Gene id: 2113
Gene description: v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
Synonyms: ETS-1; EWSR2; c-ets-1; p54; protein C-ets-1; Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2 oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1; ETS proto-oncogene 1, transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcggccgtcgatctcaagccgactctcaccatcatcaagacggaaaaagtcgatctggagcttttcccctccccggatatggaatgtgcagatgtcccactattaactccaagcagcaaagaaatgatgtctcaagcattaaaagctactttcagtggtttcactaaagaacagcaacgactggggatcccaaaagacccccggcagtggacagaaacccatgttcgggactgggtgatgtgggctgtgaatgaattcagcctgaaaggtgtagacttccagaagttctgtatgaatggagcagccctctgcgccctgggtaaagactgctttctcgagctggccccagactttgttggggacatcttatgggaacatctagagatcctgcagaaagaggatgtgaaaccatatcaagttaatggagtcaacccagcctatccagaatcccgctatacctcggattacttcattagctatggtattgagcatgcccagtgtgttccaccatcggagttctcagagcccagcttcatcacagagtcctatcagacgctccatcccatcagctcggaagagctcctctccctcaagtatgagaatgactacccctcggtcattctccgagaccctctccagacagacaccttgcagaatgactactttgctatcaaacaagaagtcgtcaccccagacaacatgtgcatggggaggaccagtcgtggtaaactcgggggccaggactcttttgaaagcatagagagctacgatagttgtggccaggagatggggaaagaggaaaaacaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: