Cart 5 Product Products 1 239,72 € (empty)
-
1 x MOAP1-modu...121,50 € -
1 x IL1RAP-int...121,50 € -
1 x PGD-phosph...121,50 € -
-
No products
To be determined Shipping
1 239,72 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 239,72 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 239,72 €
View larger 
ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene
PTXBC017314
New product
Data sheet of ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017314 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ETS1 |
| Origin species: | Human |
| Product name: | ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene |
| Size: | 2ug |
| Accessions: | BC017314 |
| Gene id: | 2113 |
| Gene description: | v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) |
| Synonyms: | ETS-1; EWSR2; c-ets-1; p54; protein C-ets-1; Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2 oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1; ETS proto-oncogene 1, transcription factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggcggccgtcgatctcaagccgactctcaccatcatcaagacggaaaaagtcgatctggagcttttcccctccccggatatggaatgtgcagatgtcccactattaactccaagcagcaaagaaatgatgtctcaagcattaaaagctactttcagtggtttcactaaagaacagcaacgactggggatcccaaaagacccccggcagtggacagaaacccatgttcgggactgggtgatgtgggctgtgaatgaattcagcctgaaaggtgtagacttccagaagttctgtatgaatggagcagccctctgcgccctgggtaaagactgctttctcgagctggccccagactttgttggggacatcttatgggaacatctagagatcctgcagaaagaggatgtgaaaccatatcaagttaatggagtcaacccagcctatccagaatcccgctatacctcggattacttcattagctatggtattgagcatgcccagtgtgttccaccatcggagttctcagagcccagcttcatcacagagtcctatcagacgctccatcccatcagctcggaagagctcctctccctcaagtatgagaatgactacccctcggtcattctccgagaccctctccagacagacaccttgcagaatgactactttgctatcaaacaagaagtcgtcaccccagacaacatgtgcatggggaggaccagtcgtggtaaactcgggggccaggactcttttgaaagcatagagagctacgatagttgtggccaggagatggggaaagaggaaaaacaaacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa - protein phosphatase 1, regulatory (inhibitor) subunit 3C - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 - par-6 partitioning defective 6 homolog alpha (C. elegans) |