HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene View larger

HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene

PTXBC024194

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024194
Product type: DNA & cDNA
Ncbi symbol: HMGCLL1
Origin species: Human
Product name: HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene
Size: 2ug
Accessions: BC024194
Gene id: 54511
Gene description: 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
Synonyms: bA418P12.1; er-cHL; 3-hydroxymethyl-3-methylglutaryl-CoA lyase, cytoplasmic; 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like protein 1; 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1; endoplasmic reticulum 3-hydroxymethyl-3-methylglutaryl-CoA lyase; 3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaatgtgccatccgcggtgaagcactgcctcagctaccagcagcttctccgggagcatctctggatcggggattcagtggcaggggcgctcgaccccgcgcaggaaacatcccagttatctggactccctgagtttgttaaaatagtagaagttgggcctagggatggattgcagaatgaaaaggttatagttcctacagatataaaaattgaatttatcaatcgactttcccaaactggcttgtctgtaatagaagtgactagctttgtgtcttccagatgggtaccacagatggctgatcacactgaagtaatgaaaggcattcatcaatatccaggagttcgctatcctgtccttactcctaatcttcagggttttcaccatgctgttgctgctggagctactgagatatcagtttttggagctgcatctgaatcctttagcaagaagaatattaactgttccattgaagaaagtatgggaaaatttgaggaggttgttaagtctgcaagacacatgaatattccagcacgagggtatgtgtcttgtgctctgggctgtccatatgaaggaagtattacaccgcaaaaagtgacagaagtgtctaagagattgtacggcatgggttgttatgagatctctctaggagacacaattggagtgggaactccaggaagtatgaaaagaatgttggaaagtgtgatgaaagaaatcccaccaggtgctcttgctgttcactgtcatgacacatacggacaagccttagcaaatatccttacggcccttcagatgggaattaatgtggtggactccgcagtatccggattaggtggctgcccttatgcaaaaggtgcttctgggaatgtagccactgaggatttgatatatatgcttaatggcctggggctcaatacaggtgtgaatctatacaaagtgatggaagctggtgactttatttgcaaagctgtgaataaaaccacaaactctaaagtagcacaagcctccttcaatgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - par-6 partitioning defective 6 homolog alpha (C. elegans)
- SAM domain, SH3 domain and nuclear localization signals 1
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
- ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1

Buy HMGCLL1-3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Gene now

Add to cart