Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PARD6A-par-6 partitioning defective 6 homolog alpha (C. elegans) Gene
PTXBC015626
New product
Data sheet of PARD6A-par-6 partitioning defective 6 homolog alpha (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PARD6A-par-6 partitioning defective 6 homolog alpha (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015626 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PARD6A |
| Origin species: | Human |
| Product name: | PARD6A-par-6 partitioning defective 6 homolog alpha (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC015626 |
| Gene id: | 50855 |
| Gene description: | par-6 partitioning defective 6 homolog alpha (C. elegans) |
| Synonyms: | PAR-6A; PAR6; PAR6C; PAR6alpha; TAX40; TIP-40; partitioning defective 6 homolog alpha; PAR-6 alpha; Tax-interacting protein 40; par-6 partitioning defective 6 homolog alpha; partitioning-defective protein 6; tax interaction protein 40; par-6 family cell polarity regulator alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccggccgcagaggactccggcgcgcagtcccgatagcatcgtcgaggtgaagagcaaatttgacgccgagttccgacgcttcgcgctgcctcgcgcttcggtgagcggcttccaggagttctcgcggttgctgcgggcggtgcaccagatcccgggcctggacgtgctacttggctatacggatgctcatggcgacctgctgcccctcaccaacgacgacagcctgcaccgggccctggccagcgggcccccgccactgcgcctactggtgcagaagcgggaagctgactccagcggcctggcttttgcctccaactctctgcagcggcgcaagaaagggctcttgctgcggccagtggcacccctgcgcacccggccacccttgctaatcagcctgccccaagatttccgccaggtttcctcagtcatagacgtggacctactgcctgagacccaccgacgggtgcggctgcacaagcatggttcagaccgccccctgggcttctacatccgagatggcatgagcgtgcgtgtggctccccagggcctggagcgggttccaggaatcttcatctcccgcctggtacgtgggggtctggctgagagtacagggctgctggcggtcagtgatgagatcctcgaggtcaatggcattgaagtagccgggaagaccttggaccaagtgacggacatgatggttgccaacagccataacctcattgtcactgtcaagcccgccaaccagcgcaataacgtggtgcgaggggcatctgggcgtttgacaggtcctccctctgcagggcctgggcctgctgagcctgatagtgacgatgacagcagtgacctggtcattgagaaccgccagcctcccagttccaatgggctgtctcaggggcccccgtgctgggacctgcaccctggctgccgacatcctggtacccgcagctctctgccctccctggatgaccaggagcaggccagttctggctgggggagtcgcattcgaggagatggtagtggcttcagcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SAM domain, SH3 domain and nuclear localization signals 1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 - ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 - solute carrier family 18 (vesicular monoamine), member 1 |