Login to display prices
Login to display prices
SAMSN1-SAM domain, SH3 domain and nuclear localization signals 1 Gene View larger

SAMSN1-SAM domain, SH3 domain and nuclear localization signals 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAMSN1-SAM domain, SH3 domain and nuclear localization signals 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAMSN1-SAM domain, SH3 domain and nuclear localization signals 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029112
Product type: DNA & cDNA
Ncbi symbol: SAMSN1
Origin species: Human
Product name: SAMSN1-SAM domain, SH3 domain and nuclear localization signals 1 Gene
Size: 2ug
Accessions: BC029112
Gene id: 64092
Gene description: SAM domain, SH3 domain and nuclear localization signals 1
Synonyms: NASH1; SASH2; SH3D6B; SLy2; SAM domain-containing protein SAMSN-1; SAM and SH3 domain containing 2; SAM domain, SH3 domain and nuclear localisation signals, 1; SAM domain, SH3 domain and nuclear localization signals protein 1; SH3-SAM adaptor protein; Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2; hematopoietic adapter-containing SH3 and sterile α-motif (SAM) domains 1; hematopoietic adapter-containing SH3 and sterile alpha-motif (SAM) domains 1; hematopoietic adaptor containing SH3 and SAM domains 1; nuclear localization signals, SAM and SH3 domain containing 1; SAM domain, SH3 domain and nuclear localization signals 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcaagagaaagccatccaatgtttcagagaaggagaaacatcaaaaaccaaagcgaagcagcagttttgggaatttcgatcgttttcggaataattctttatcaaaaccagatgattcaactgaggcacatgaaggagatcccacaaatggaagtggagaacaaagtaaaacttcaaataatggaggcggtttgggtaaaaaaatgagagctatttcatggacaatgaagaaaaaagtgggtaaaaagtacatcaaagccctttctgaggaaaaggatgaggaagatggagagaatgcccacccatatagaaacagtgaccctgtgattgggacccacacagagaaggtgtccctcaaagccagtgactccatggatagtctctacagtggacagagctcatcaagtggcataacaagctgttcagatggtacaagtaaccgggacagctttcgactggatgacgatggcccctattcaggaccattctgtggccgtgccagagtgcatacggatttcacgccaagtccctatgacactgactccctcaaaatcaagaaaggagacatcatagacattatttgcaaaacaccaatggggatgtggacaggaatgttgaacaataaagtgggaaacttcaaattcatttatgtggatgtcatctcagaagaggaagcagcccccaagaaaataaaggcaaaccgaaggagtaacagcaaaaaatccaagactctgcaggagttcctagagaggattcatctgcaggaatacacctcaacacttttgctcaatggttatgagactctagaagatttaaaagatataaaagagagtcacctcattgaattaaatattgaaaacccagatgacagaagaaggttactatcagctgctgaaaacttccttgaagaagaaattattcaagagcaagaaaatgaacctgagcccctatccttgagctcagacatctccttaaataagtcacagttagatgactgcccaagggactctggttgctatatctcatcaggaaattcagataatggcaaagaggatctggagtctgaaaatctgtctgacatggtacataagattattatcacagagccaagtgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
- ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
- solute carrier family 18 (vesicular monoamine), member 1
- pleckstrin homology domain containing, family O member 1