Login to display prices
Login to display prices
SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene View larger

SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene

PTXBC009387

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene

Proteogenix catalog: PTXBC009387
Ncbi symbol: SLC18A1
Product name: SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene
Size: 2ug
Accessions: BC009387
Gene id: 6570
Gene description: solute carrier family 18 (vesicular monoamine), member 1
Synonyms: CGAT; VAT1; VMAT1; chromaffin granule amine transporter; solute carrier family 18 (vesicular monoamine transporter), member 1; solute carrier family 18 (vesicular monoamine), member 1; solute carrier family 18 member 1; vesicular amine transporter 1; solute carrier family 18 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccggaccattctggatgctccccagcggttgctgaaggaggggagagcgtcccggcagctggtgctggtggtggtattcgtcgctttgctcctggacaacatgctgtttactgtggtggtgccaattgtgcccaccttcctatatgacatggagttcaaagaagtcaactcttctctgcacctcggccatgccggaagttccccacatgccctcgcctctcctgccttttccaccatcttctccttcttcaacaacaacaccgtggctgttgaagaaagcgtacctagtggaatagcatggatgaatgacactgccagcaccatcccacctccagccactgaagccatctcagctcataaaaacaactgcttgcaaggcacaggtttcttggaggaagagattacccgggtcggggttctgtttgcttcaaaggctgtgatgcaacttctggtcaacccattcgtgggccctctcaccaacaggattggatatcatatccccatgtttgctggctttgttatcatgtttctctccacagttatgtttgctttttctgggacctatactctactctttgtggcccgaacccttcaaggcattggatcttcattttcatctgttgcaggtcttggaatgctggccagtgtctacactgatgaccatgagagaggacgagccatgggaactgctctggggggcctggccttggggttgctggtgggagctccctttggaagtgtaatgtacgagtttgttgggaagtctgcacccttcctcatcctggccttcctggcactactggatggagcactccagctttgcatcctacagccttccaaagtctctcctgagagtgccaaggggactcccctctttatgcttctcaaagacccttacatcctggtggctgcagggtccatctgctttgccaacatgggggtggccatcctggagcccacactgcccatctggatgatgcagaccatgtgctcccccaagtggcagctgggtctagctttcttgcctgccagtgtgtcctacctcattggcaccaacctctttggtgtgttggccaacaagatgggtcggtggctgtgttccctaatcgggatgctggtagtaggtaccagcttgctctgtctaccaagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: