Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene
PTXBC009387
New product
Data sheet of SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC18A1 |
| Origin species: | Human |
| Product name: | SLC18A1-solute carrier family 18 (vesicular monoamine), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC009387 |
| Gene id: | 6570 |
| Gene description: | solute carrier family 18 (vesicular monoamine), member 1 |
| Synonyms: | CGAT; VAT1; VMAT1; chromaffin granule amine transporter; solute carrier family 18 (vesicular monoamine transporter), member 1; solute carrier family 18 (vesicular monoamine), member 1; solute carrier family 18 member 1; vesicular amine transporter 1; solute carrier family 18 member A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctccggaccattctggatgctccccagcggttgctgaaggaggggagagcgtcccggcagctggtgctggtggtggtattcgtcgctttgctcctggacaacatgctgtttactgtggtggtgccaattgtgcccaccttcctatatgacatggagttcaaagaagtcaactcttctctgcacctcggccatgccggaagttccccacatgccctcgcctctcctgccttttccaccatcttctccttcttcaacaacaacaccgtggctgttgaagaaagcgtacctagtggaatagcatggatgaatgacactgccagcaccatcccacctccagccactgaagccatctcagctcataaaaacaactgcttgcaaggcacaggtttcttggaggaagagattacccgggtcggggttctgtttgcttcaaaggctgtgatgcaacttctggtcaacccattcgtgggccctctcaccaacaggattggatatcatatccccatgtttgctggctttgttatcatgtttctctccacagttatgtttgctttttctgggacctatactctactctttgtggcccgaacccttcaaggcattggatcttcattttcatctgttgcaggtcttggaatgctggccagtgtctacactgatgaccatgagagaggacgagccatgggaactgctctggggggcctggccttggggttgctggtgggagctccctttggaagtgtaatgtacgagtttgttgggaagtctgcacccttcctcatcctggccttcctggcactactggatggagcactccagctttgcatcctacagccttccaaagtctctcctgagagtgccaaggggactcccctctttatgcttctcaaagacccttacatcctggtggctgcagggtccatctgctttgccaacatgggggtggccatcctggagcccacactgcccatctggatgatgcagaccatgtgctcccccaagtggcagctgggtctagctttcttgcctgccagtgtgtcctacctcattggcaccaacctctttggtgtgttggccaacaagatgggtcggtggctgtgttccctaatcgggatgctggtagtaggtaccagcttgctctgtctaccaagttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family O member 1 - solute carrier family 18 (vesicular monoamine), member 1 - phosphatidylinositol-4-phosphate 5-kinase, type I, alpha - v-myb myeloblastosis viral oncogene homolog (avian)-like 2 |