PIP5K1A-phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Gene View larger

PIP5K1A-phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Gene


New product

Data sheet of PIP5K1A-phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIP5K1A-phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007833
Product type: DNA & cDNA
Ncbi symbol: PIP5K1A
Origin species: Human
Product name: PIP5K1A-phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Gene
Size: 2ug
Accessions: BC007833
Gene id: 8394
Gene description: phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Synonyms: phosphatidylinositol 4-phosphate 5-kinase type-1 alpha; 68 kDa type I phosphatidylinositol 4-phosphate 5-kinase alpha; PIP5K1-alpha; PIP5KIalpha; phosphatidylinositol 4-phosphate 5-kinase type I alpha; ptdIns(4)P-5-kinase 1 alpha; phosphatidylinositol-4-phosphate 5-kinase type 1 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcggcctcctccgggccgtcgtcttcggtcggtttttcatcctttgatcccgcggtcccttcctgtaccttgtcctcagcatctggaatcaagagacccatggcatctgaggtgccttatgcctctggcatgcccatcaagaaaataggccatagaagtgttgattcctcaggagagacaacatataaaaagacaacctcatcagccttgaaaggtgccatccagttaggcattacccacactgtggggagcctgagtaccaaaccagagcgtgatgtcctcatgcaagatttctacgtggttgagagtatcttctttcccagtgaagggagcaacctgacccctgctcatcactacaatgactttcgtttcaagacctatgcacctgttgccttccgctacttccgggagctatttggtatccggcccgatgattacttgtattccctctgcagtgagccgctgattgaactctgtagctctggagctagtggttccctattctatgtgtccagcgacgatgagttcattattaagacagtccaacataaagaggcggaatttctgcagaagctgcttccaggatactacatgaacctcaaccagaaccctcggactttgctgcctaaattctatggactgtactgtgtgcaggcaggtggcaagaacattcggattgtggtgatgaacaatcttttaccaagatcggtaaaaatgcatatcaaatatgacctcaaaggctcaacctacaaacggcgggcttcccagaaagagcgagagaagcctcttcccacatttaaagacctagacttcttacaagacatccctgatggtctttttttggatgctgacatgtacaacgctctctgtaagaccctgcagcgtgactgtttggtgctgcagagcttcaagataatggattatagcctcttgatgtcaatccataatatagatcatgcacaacgagagcccttaagcagtgaaacacagtactcagttgatactcgaagaccggccccccaaaaggctctgtattccacagccatggaatccatccagggagaggctcgacggggtggtaccatggagactgatgaccatatgggtggcatccctgcccggaatagtaaaggggaaaggcttctgctttatattggcatcattgacattctacagtcttacaggtttgttaagaagttggagcactcttggaaagccctggtacatgacggagacactgtctcagtgcatcgcccaggcttctacgctgaacggttccagcgcttcatgtgcaacacagtatttaagaagattccctgcgttcaccttggtcgtcctgatgttttacctcagactccacctttggaggaaatcagtgagggctcgcctattcctgaccccagtttctcacctctagttggagagactttgcaaatgctaactacaagtacaaccttggaaaagcttgaagttgcagagtcagagttcacccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-myb myeloblastosis viral oncogene homolog (avian)-like 2
- ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
- LysM, putative peptidoglycan-binding, domain containing 2
- tumor necrosis factor receptor superfamily, member 12A