TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene View larger

TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene

PTXBC002718

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002718
Product type: DNA & cDNA
Ncbi symbol: TNFRSF12A
Origin species: Human
Product name: TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene
Size: 2ug
Accessions: BC002718
Gene id: 51330
Gene description: tumor necrosis factor receptor superfamily, member 12A
Synonyms: CD266; FN14; TWEAKR; tumor necrosis factor receptor superfamily member 12A; FGF-inducible 14; fibroblast growth factor-inducible immediate-early response protein 14; tweak-receptor; type I transmembrane protein Fn14; TNF receptor superfamily member 12A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcggggctcgctgcgccggttgctgcggctcctcgtgctggggctctggctggcgttgctgcgctccgtggccggggagcaagcgccaggcaccgccccctgctcccgcggcagctcctggagcgcggacctggacaagtgcatggactgcgcgtcttgcagggcgcgaccgcacagcgacttctgcctgggctgcgctgcagcacctcctgcccccttccggctgctttggcccatccttgggggcgctctgagcctgaccttcgtgctggggctgctttctggctttttggtctggagacgatgccgcaggagagagaagttcaccacccccatagaggagaccggcggagagggctgcccagctgtggcgctgatccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin, light chain 6, alkali, smooth muscle and non-muscle
- asparagine-linked glycosylation 13 homolog (S. cerevisiae)
- heat shock 27kDa protein family, member 7 (cardiovascular)
- thioredoxin domain containing 12 (endoplasmic reticulum)

Buy TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene now

Add to cart