Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene
PTXBC005336
New product
Data sheet of ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALG13 |
| Origin species: | Human |
| Product name: | ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC005336 |
| Gene id: | 79868 |
| Gene description: | asparagine-linked glycosylation 13 homolog (S. cerevisiae) |
| Synonyms: | ALG13, UDP-N-acetylglucosaminyltransferase subunit; UDP-N-acetylglucosamine transferase subunit ALG13 homolog; CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W; N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase; asparagine-linked glycosylation 13 homolog; glycosyltransferase 28 domain-containing protein 1; hematopoietic stem/progenitor cells protein MDS031; tudor domain containing 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtgcgtgtttgttaccgtagggaccaccagctttgacgacctcattgcgtgtgtgtcggcgcccgacagtctgcaaaaaatcgagagccttggttacaaccgacttatcctgcaaattggtagaggaacggtggtacctgaacccttcagtactgagtcgtttactctggatgtttacaggtacaaggattccttgaaagaagacattcagaaagcagatcttgttattagtcacgcaggtgcaggaagctgtttggagactctggaaaaaggaaagccactcgtagtggttataaacgaaaagttgatgaacaatcatcagctggaactggcaaagcagctacacaaagagggtcatctcttctattgtacctgcagcacgcttcctgggctgttacagtcaatggacttatcaacactgaaatgttatcctcctggccagccagaaaaattttctgcatttttggataaagttgttggattacaaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock 27kDa protein family, member 7 (cardiovascular) - thioredoxin domain containing 12 (endoplasmic reticulum) - asparagine-linked glycosylation 14 homolog (S. cerevisiae) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) |