Login to display prices
Login to display prices
ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene View larger

ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005336
Product type: DNA & cDNA
Ncbi symbol: ALG13
Origin species: Human
Product name: ALG13-asparagine-linked glycosylation 13 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005336
Gene id: 79868
Gene description: asparagine-linked glycosylation 13 homolog (S. cerevisiae)
Synonyms: ALG13, UDP-N-acetylglucosaminyltransferase subunit; UDP-N-acetylglucosamine transferase subunit ALG13 homolog; CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W; N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase; asparagine-linked glycosylation 13 homolog; glycosyltransferase 28 domain-containing protein 1; hematopoietic stem/progenitor cells protein MDS031; tudor domain containing 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgcgtgtttgttaccgtagggaccaccagctttgacgacctcattgcgtgtgtgtcggcgcccgacagtctgcaaaaaatcgagagccttggttacaaccgacttatcctgcaaattggtagaggaacggtggtacctgaacccttcagtactgagtcgtttactctggatgtttacaggtacaaggattccttgaaagaagacattcagaaagcagatcttgttattagtcacgcaggtgcaggaagctgtttggagactctggaaaaaggaaagccactcgtagtggttataaacgaaaagttgatgaacaatcatcagctggaactggcaaagcagctacacaaagagggtcatctcttctattgtacctgcagcacgcttcctgggctgttacagtcaatggacttatcaacactgaaatgttatcctcctggccagccagaaaaattttctgcatttttggataaagttgttggattacaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heat shock 27kDa protein family, member 7 (cardiovascular)
- thioredoxin domain containing 12 (endoplasmic reticulum)
- asparagine-linked glycosylation 14 homolog (S. cerevisiae)
- proteasome (prosome, macropain) inhibitor subunit 1 (PI31)