Login to display prices
Login to display prices
ALG14-asparagine-linked glycosylation 14 homolog (S. cerevisiae) Gene View larger

ALG14-asparagine-linked glycosylation 14 homolog (S. cerevisiae) Gene

PTXBC011706

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALG14-asparagine-linked glycosylation 14 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALG14-asparagine-linked glycosylation 14 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC011706
Ncbi symbol: ALG14
Product name: ALG14-asparagine-linked glycosylation 14 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011706
Gene id: 199857
Gene description: asparagine-linked glycosylation 14 homolog (S. cerevisiae)
Synonyms: ALG14, UDP-N-acetylglucosaminyltransferase subunit; UDP-N-acetylglucosamine transferase subunit ALG14 homolog; CMS15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgcgttctcgttctagctgcggccgcaggagctgtggcggttttcctaatcctgcgaatatgggtagtgcttcgttccatggacgttacgccccgggagtctctcagtatcttggtagtggctgggtccggtgggcataccactgagatcctgaggctgcttgggagcttgtccaatgcctactcacctagacattatgtcattgctgacactgatgaaatgagtgccaataaaataaattcttttgaactagatcgagctgatagagaccctagtaacatgtataccaaatactacattcaccgaattccaagaagccgggaggttcagcagtcctggccctccaccgttttcaccaccttgcactccatgtggctctcctttcccctaattcacagggtgaagccagatttggtgttgtgtaacggaccaggaacatgtgttcctatctgtgtatctgcccttctccttgggatactaggaataaagaaagtgatcattgtctacgttgaaagcatctgccgtgtagaaacgttatccatgtccggaaagattctgtttcatctctcagattacttcattgttcagtggccggctctgaaagaaaagtatcccaaatcggtgtaccttgggcgaattgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: