UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene View larger

UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005182
Product type: DNA & cDNA
Ncbi symbol: UTP11L
Origin species: Human
Product name: UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene
Size: 2ug
Accessions: BC005182
Gene id: 51118
Gene description: UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
Synonyms: UTP11L; CGI-94; CGI94; U3 snoRNA-associated protein 11; UTP11-like protein; UTP11-like, U3 small nucleolar ribonucleoprotein; UTP11, small subunit processome component homolog (S. cerevisiae)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcttttcggaaggcggctaagtcccggcagcgggaacacagagagcgaagccagcctggctttcgaaaacatctgggcctgctggagaaaaagaaagattacaaacttcgtgcagatgactaccgtaaaaaacaagaatacctcaaagctcttcggaagaaggctcttgaaaaaaatccagatgaattctactacaaaatgactcgggttaaactccaggatggagtacatattattaaggagactaaggaagaagtaaccccagaacaactaaagctgatgagaactcaggacgtcaaatatatagaaatgaagagggttgcagaagctaagaaaatcgaaagactaaaatcagagctccatctgctggatttccaggggaagcaacagaacaagcatgtgttcttttttgacaccaaaaaggaagttgaacagtttgatgtcgcaactcacctgcaaacagccccggagctagtcgacagagtctttaataggcccaggatagagaccttgcagaaagaaaaagtgaaaggagttaccaatcagactggacttaagcggatagctaaagaaaggcaaaagcagtataactgcctgacacagcggattgaacgagagaagaaattgttcgttattgctcagaaaattcaaacacgcaaagatcttatggataaaactcagaaagtgaaggtgaagaaagaaacggtgaactccccagctatttataaatttcagagtcgtcgaaaacgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
- N-ethylmaleimide-sensitive factor attachment protein, alpha
- N-acetylglucosamine-1-phosphate transferase, gamma subunit
- spastic paraplegia 21 (autosomal recessive, Mast syndrome)

Buy UTP11L-UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) Gene now

Add to cart