GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene View larger

GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene

PTXBC014592

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014592
Product type: DNA & cDNA
Ncbi symbol: GNPTG
Origin species: Human
Product name: GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene
Size: 2ug
Accessions: BC014592
Gene id: 84572
Gene description: N-acetylglucosamine-1-phosphate transferase, gamma subunit
Synonyms: C16orf27; GNPTAG; LP2537; RJD9; N-acetylglucosamine-1-phosphotransferase subunit gamma; UDP-N-acetylglucosamine-1-phosphotransferase subunit gamma; glcNAc-1-phosphotransferase subunit gamma; N-acetylglucosamine-1-phosphate transferase gamma subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggggctggcgcggctcctgttgctcctcgggctctcggccggcgggcccgcgccggcaggtgcagcgaagatgaaggtggtggaggagcccaacgcgtttggggtgaacaacccgttcttgcctcaggccagtcgcctccaggccaagagggatccttcacccgtgtctggacccgtgcatctcttccgactctcgggcaagtgcttcagcctggtggagtccacgtacaagtatgagttctgcccgttccacaacgtgacccagcacgagcagaccttccgctggaacgcctacagtgggatcctcggcatctggcacgagtgggagatcgccaacaacaccttcacgggcatgtggatgagggacggtgacgcctgccgttcccggagccggcagagcaaggtggagctggcgtgtggaaaaagcaaccggctggcccatgtgtccgagccgagcacctgcgtctacgcgctgacgttcgagacccccctcgtctgccacccccacgccttgctagtgtacccaaccctgccagaggccctgcagcggcagtgggaccaggtagagcaggacctggccgatgagctgatcaccccccagggccatgagaagttgctgaggacactttttgaggatgctggctacttaaagaccccagaaaatgaacccacccagctggagggaggtcctgacagcttggggtttgagaccctggaaaactgcaggaaggctcataaagaactctcaaaggagatcaaaaggctgaaaggtttgctcacccagcacggcatcccctacacgaggcccacagaaacttccaacttggagcacttgggccacgagacgcccagagccaagtctccagagcagctgcggggtgacccaggactgcgtgggagtttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spastic paraplegia 21 (autosomal recessive, Mast syndrome)
- N-ethylmaleimide-sensitive factor attachment protein, gamma
- ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 7

Buy GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene now

Add to cart