Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene
PTXBC014592
New product
Data sheet of GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014592 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNPTG |
| Origin species: | Human |
| Product name: | GNPTG-N-acetylglucosamine-1-phosphate transferase, gamma subunit Gene |
| Size: | 2ug |
| Accessions: | BC014592 |
| Gene id: | 84572 |
| Gene description: | N-acetylglucosamine-1-phosphate transferase, gamma subunit |
| Synonyms: | C16orf27; GNPTAG; LP2537; RJD9; N-acetylglucosamine-1-phosphotransferase subunit gamma; UDP-N-acetylglucosamine-1-phosphotransferase subunit gamma; glcNAc-1-phosphotransferase subunit gamma; N-acetylglucosamine-1-phosphate transferase gamma subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggggctggcgcggctcctgttgctcctcgggctctcggccggcgggcccgcgccggcaggtgcagcgaagatgaaggtggtggaggagcccaacgcgtttggggtgaacaacccgttcttgcctcaggccagtcgcctccaggccaagagggatccttcacccgtgtctggacccgtgcatctcttccgactctcgggcaagtgcttcagcctggtggagtccacgtacaagtatgagttctgcccgttccacaacgtgacccagcacgagcagaccttccgctggaacgcctacagtgggatcctcggcatctggcacgagtgggagatcgccaacaacaccttcacgggcatgtggatgagggacggtgacgcctgccgttcccggagccggcagagcaaggtggagctggcgtgtggaaaaagcaaccggctggcccatgtgtccgagccgagcacctgcgtctacgcgctgacgttcgagacccccctcgtctgccacccccacgccttgctagtgtacccaaccctgccagaggccctgcagcggcagtgggaccaggtagagcaggacctggccgatgagctgatcaccccccagggccatgagaagttgctgaggacactttttgaggatgctggctacttaaagaccccagaaaatgaacccacccagctggagggaggtcctgacagcttggggtttgagaccctggaaaactgcaggaaggctcataaagaactctcaaaggagatcaaaaggctgaaaggtttgctcacccagcacggcatcccctacacgaggcccacagaaacttccaacttggagcacttgggccacgagacgcccagagccaagtctccagagcagctgcggggtgacccaggactgcgtgggagtttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spastic paraplegia 21 (autosomal recessive, Mast syndrome) - N-ethylmaleimide-sensitive factor attachment protein, gamma - ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |