SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene View larger

SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene

PTXBC000244

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000244
Product type: DNA & cDNA
Ncbi symbol: SPG21
Origin species: Human
Product name: SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene
Size: 2ug
Accessions: BC000244
Gene id: 51324
Gene description: spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Synonyms: BM-019; GL010; MAST; maspardin; acid cluster protein 33; spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagagattaaagtctctcctgattataactggtttagaggtacagttccccttaaaaagattattgtggatgatgatgacagtaagatatggtcgctctatgacgcgggcccccgaagtatcaggtgtcctctcatattcctgccccctgtcagtggaactgcagatgtctttttccggcagattttggctctgactggatggggttaccgggttatcgctttgcagtatccagtttattgggaccatctcgagttctgtgatggattcagaaaacttttagaccatttacaattggataaagttcatctttttggcgcttctttgggaggctttttggcccagaaatttgctgaatacactcacaaatctcctagagtccattccctaatcctctgcaattccttcagtgacacctctatcttcaaccaaacttggactgcaaacagcttttggctgatgcctgcatttatgctcaaaaaaatagttcttggaaatttttcatctggcccggtggaccctatgatggctgatgccattgatttcatggtagacaggctagaaagtttgggtcagagtgaactggcttcaagacttaccttgaattgtcaaaattcttatgtggaacctcataaaattcgggacatacctgtaactattatggatgtgtttgatcagagtgcgctttcaactgaagctaaagaagaaatgtacaagctgtatcctaatgcccgaagagctcatctgaaaacaggaggcaatttcccatacctgtgcagaagtgcagaggtcaatctttatgtacagatacatttgctgcaattccatggaaccaaatacgcggccattgacccatcaatggtcagtgccgaggagcttgaggtgcagaaaggcagccttggcatcagccaggaggagcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-ethylmaleimide-sensitive factor attachment protein, gamma
- ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
- ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2

Buy SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene now

Add to cart