Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene
PTXBC000244
New product
Data sheet of SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000244 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPG21 |
| Origin species: | Human |
| Product name: | SPG21-spastic paraplegia 21 (autosomal recessive, Mast syndrome) Gene |
| Size: | 2ug |
| Accessions: | BC000244 |
| Gene id: | 51324 |
| Gene description: | spastic paraplegia 21 (autosomal recessive, Mast syndrome) |
| Synonyms: | BM-019; GL010; MAST; maspardin; acid cluster protein 33; spastic paraplegia 21 (autosomal recessive, Mast syndrome) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagagattaaagtctctcctgattataactggtttagaggtacagttccccttaaaaagattattgtggatgatgatgacagtaagatatggtcgctctatgacgcgggcccccgaagtatcaggtgtcctctcatattcctgccccctgtcagtggaactgcagatgtctttttccggcagattttggctctgactggatggggttaccgggttatcgctttgcagtatccagtttattgggaccatctcgagttctgtgatggattcagaaaacttttagaccatttacaattggataaagttcatctttttggcgcttctttgggaggctttttggcccagaaatttgctgaatacactcacaaatctcctagagtccattccctaatcctctgcaattccttcagtgacacctctatcttcaaccaaacttggactgcaaacagcttttggctgatgcctgcatttatgctcaaaaaaatagttcttggaaatttttcatctggcccggtggaccctatgatggctgatgccattgatttcatggtagacaggctagaaagtttgggtcagagtgaactggcttcaagacttaccttgaattgtcaaaattcttatgtggaacctcataaaattcgggacatacctgtaactattatggatgtgtttgatcagagtgcgctttcaactgaagctaaagaagaaatgtacaagctgtatcctaatgcccgaagagctcatctgaaaacaggaggcaatttcccatacctgtgcagaagtgcagaggtcaatctttatgtacagatacatttgctgcaattccatggaaccaaatacgcggccattgacccatcaatggtcagtgccgaggagcttgaggtgcagaaaggcagccttggcatcagccaggaggagcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-ethylmaleimide-sensitive factor attachment protein, gamma - ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 - ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 |