Login to display prices
Login to display prices
NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene View larger

NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

PTXBC001889

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

Proteogenix catalog: PTXBC001889
Ncbi symbol: NAPG
Product name: NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene
Size: 2ug
Accessions: BC001889
Gene id: 8774
Gene description: N-ethylmaleimide-sensitive factor attachment protein, gamma
Synonyms: GAMMASNAP; gamma-soluble NSF attachment protein; N-ethylmaleimide-sensitive factor attachment protein, gamma; SNAP-gamma; gamma SNAP; soluble NSF attachment protein; NSF attachment protein gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctcagaagataaacgaggggctggaacacctcgccaaagcagagaaatacctgaaaactggttttttaaaatggaagccagattatgacagtgccgcttctgaatatggaaaagcagctgttgcttttaaaaatgccaaacagtttgagcaagcaaaagatgcctgcctgagggaagctgttgcccatgaaaataatagggctctttttcatgctgccaaagcttatgagcaagctggaatgatgttgaaggagatgcagaaactaccagaggccgttcagctaattgagaaggccagcatgatgtatctagaaaacggcaccccagacacagcagccatggctttggagcgagctggaaagcttatagaaaatgttgatccagagaaggctgtacagttatatcaacagacagctaatgtgtttgaaaatgatgaacgcttacgacaggcagttgaattactaggaaaagcctccagactactagtacgaggacgtaggtttgatgaggcggcactctctattcagaaagaaaaaaatatttataaggaaattgagaattatccaacttgttataagaaaacaattgctcaagtcttagttcatctacacagaaatgactatgtagctgcagaaagatgtgtccgggagagctatagcatccctgggttcaatggcagtgaagactgtgctgccctggaacagcttcttgaaggttatgaccagcaagaccaagatcaggtgtcagatgtctgcaactcaccgcttttcaagtacatggacaatgattatgctaagctgggcctgagtttggtggttccaggagggggaatcaagaagaaatcacctgcaacaccacaggccaagcctgatggtgtcactgccacggctgctgatgaagaggaagatgaatactcaggaggactatgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: