NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene View larger

NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

PTXBC001889

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001889
Product type: DNA & cDNA
Ncbi symbol: NAPG
Origin species: Human
Product name: NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene
Size: 2ug
Accessions: BC001889
Gene id: 8774
Gene description: N-ethylmaleimide-sensitive factor attachment protein, gamma
Synonyms: GAMMASNAP; gamma-soluble NSF attachment protein; N-ethylmaleimide-sensitive factor attachment protein, gamma; SNAP-gamma; gamma SNAP; soluble NSF attachment protein; NSF attachment protein gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctcagaagataaacgaggggctggaacacctcgccaaagcagagaaatacctgaaaactggttttttaaaatggaagccagattatgacagtgccgcttctgaatatggaaaagcagctgttgcttttaaaaatgccaaacagtttgagcaagcaaaagatgcctgcctgagggaagctgttgcccatgaaaataatagggctctttttcatgctgccaaagcttatgagcaagctggaatgatgttgaaggagatgcagaaactaccagaggccgttcagctaattgagaaggccagcatgatgtatctagaaaacggcaccccagacacagcagccatggctttggagcgagctggaaagcttatagaaaatgttgatccagagaaggctgtacagttatatcaacagacagctaatgtgtttgaaaatgatgaacgcttacgacaggcagttgaattactaggaaaagcctccagactactagtacgaggacgtaggtttgatgaggcggcactctctattcagaaagaaaaaaatatttataaggaaattgagaattatccaacttgttataagaaaacaattgctcaagtcttagttcatctacacagaaatgactatgtagctgcagaaagatgtgtccgggagagctatagcatccctgggttcaatggcagtgaagactgtgctgccctggaacagcttcttgaaggttatgaccagcaagaccaagatcaggtgtcagatgtctgcaactcaccgcttttcaagtacatggacaatgattatgctaagctgggcctgagtttggtggttccaggagggggaatcaagaagaaatcacctgcaacaccacaggccaagcctgatggtgtcactgccacggctgctgatgaagaggaagatgaatactcaggaggactatgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
- ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
- short chain dehydrogenase/reductase family 42E, member 1

Buy NAPG-N-ethylmaleimide-sensitive factor attachment protein, gamma Gene now

Add to cart