Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1C2-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 Gene
PTXBC012142
New product
Data sheet of ATP6V1C2-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1C2-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012142 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1C2 |
| Origin species: | Human |
| Product name: | ATP6V1C2-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 Gene |
| Size: | 2ug |
| Accessions: | BC012142 |
| Gene id: | 245973 |
| Gene description: | ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 |
| Synonyms: | ATP6C2; VMA5; V-type proton ATPase subunit C 2; ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2; V-ATPase C2 subunit; vacuolar proton pump subunit C 2; ATPase H+ transporting V1 subunit C2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggagttttggttaatttctgcccctggcgataaggaaaatttgcaagctctggagaggatgaatactgtaacctccaagtccaacctgtcttataataccaaattcgctattcctgacttcaaggtggggaccttggattccctggttggcctctctgatgagttggggaaactcgacacctttgctgaaagcctcataaggagaatggctcagagcgtggtggaagtcatggaggactcaaaggggaaggtccaggagcacctcctggcaaacggagttgacttaacatcctttgtgacccactttgaatgggacatggccaaatatcctgtcaagcagccgctcgtgagtgtggtggacacaatagccaagcaactggcgcagatcgagatggacctgaagtcccgaacggccgcctacgacactctgaagacaaacctggagaacctggaaaagaaatccatggggaacctcttcacccggacactgagtgatattgtgagcaaagaggacttcgtgctggattctgaatatctcgtcacacttctggtcatcgtccccaaaccaaactactcacaatggcaaaaaacctacgaatctctctcagacatggtggtccctcgatcaaccaaactcattactgaggacaaggaagggggccttttcactgtgactctgtttcgaaaagtgattgaagatttcaaaaccaaggccaaagaaaacaagttcactgttcgtgaattttactatgatgagaaggaaattgaaagggaaagggaggagatggccagattgctgtctgataagaagcaacagtatggccccctgctgcgctggctcaaggtgaacttcagtgaagccttcattgcctggatccacatcaaggccctgagagtgtttgtggagtccgtgctcaggtatggactaccagtgaacttccaggcagtgctcctgcagccgcataagaagtcatccaccaagcgtttaagagaggttctaaactctgtcttccgacatctggatgaagtagccgctacaagtatactggatgcatctgtggagatcccgggactgcaactcaataaccaagactattttccttatgtctacttccatattgaccttagtcttcttgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - short chain dehydrogenase/reductase family 42E, member 1 - serpin peptidase inhibitor, clade I (pancpin), member 2 - tumor necrosis factor receptor superfamily, member 10b - pleckstrin homology domain containing, family O member 2 |