PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene View larger

PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008744
Product type: DNA & cDNA
Ncbi symbol: PLEKHO2
Origin species: Human
Product name: PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene
Size: 2ug
Accessions: BC008744
Gene id: 80301
Gene description: pleckstrin homology domain containing, family O member 2
Synonyms: PLEKHQ1; PP1628; pp9099; pleckstrin homology domain-containing family O member 2; PH domain-containing family O member 2; PH domain-containing family Q member 1; PH domain-containing protein; pleckstrin homology domain-containing family Q member 1; pleckstrin homology domain containing O2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggaggatgatcagaagtgtgtggagactgtggagctgggcagctatgagaagtgccaggaccttcgtgccctcctcaagcgaaaacaccgctttatcctgctgcgatccccagggaacaaggtcagcgacatcaaattccaggcacccaccggggaggagaaggaatcctggatcaaagccctcaatgaagggattaaccgaggcaaaaacaaggctttcgatgaggtaaaggtggacaagagctgcgccctggagcatgtgacacgggaccgggtgcgagggggccagcgacgccggccaccaacgagagtccacctgaaggaggtggccagtgcagcttctgacggtcttctgcgcctggatcttgatgttccggacagtgggccaccagtgtttgcccccagcaatcatgtcagtgaagcccaacctcgggagacaccccggcccctcatgcctcctaccaagcctttcctagcacctgagaccaccagccctggtgacagggtggagacccctgtgggggagagagccccaacccctgtctcagcaagctctgaggtctcccctgagagccaagaggactcagagaccccagcagaggaggacagtggctctgagcagcctcccaacagcgtcctgcctgacaaactgaaggtgagctgggagaaccccagcccccaggaggcccctgctgcagagagtgcagaaccgtcccaggcaccctgttctgagacttctgaggctgcccccagggagggtgggaagccccctacacccccacccaagatcttatcagagaaactgaaagcctccatgggtgagatgcaggcttctgggccacctgctccaggcacagtgcaggtctcagtgaatggcatggatgacagtcctgagcctgccaagccctctcaggctgagggcaccccaggaactcctccaaaggatgcaacaacatccacagcactgcccccctgggacctgccacctcagttccatccccgctgctcctcccttggggacttgcttggggaaggcccgcggcatcccttgcagcccagggaacggctatatcgggcccagctggaggtgaaggtggcctcggaacagacggagaaactgttgaacaaggtgctgggcagtgagccggcccctgttagtgccgaaacattgctcagccaggctgtggagcagctgaggcaggccacccaggtcctgcaggaaatgagagatttgggagagctgagccaggaagcacctgggctaagggagaagcggaaggagctggtgaccctctacaggagaagtgcaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 10a
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
- oxidative stress induced growth inhibitor family member 2
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 3

Buy PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene now

Add to cart