Login to display prices
Login to display prices
PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene View larger

PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene

PTXBC008744

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene

Proteogenix catalog: PTXBC008744
Ncbi symbol: PLEKHO2
Product name: PLEKHO2-pleckstrin homology domain containing, family O member 2 Gene
Size: 2ug
Accessions: BC008744
Gene id: 80301
Gene description: pleckstrin homology domain containing, family O member 2
Synonyms: PLEKHQ1; PP1628; pp9099; pleckstrin homology domain-containing family O member 2; PH domain-containing family O member 2; PH domain-containing family Q member 1; PH domain-containing protein; pleckstrin homology domain-containing family Q member 1; pleckstrin homology domain containing O2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggaggatgatcagaagtgtgtggagactgtggagctgggcagctatgagaagtgccaggaccttcgtgccctcctcaagcgaaaacaccgctttatcctgctgcgatccccagggaacaaggtcagcgacatcaaattccaggcacccaccggggaggagaaggaatcctggatcaaagccctcaatgaagggattaaccgaggcaaaaacaaggctttcgatgaggtaaaggtggacaagagctgcgccctggagcatgtgacacgggaccgggtgcgagggggccagcgacgccggccaccaacgagagtccacctgaaggaggtggccagtgcagcttctgacggtcttctgcgcctggatcttgatgttccggacagtgggccaccagtgtttgcccccagcaatcatgtcagtgaagcccaacctcgggagacaccccggcccctcatgcctcctaccaagcctttcctagcacctgagaccaccagccctggtgacagggtggagacccctgtgggggagagagccccaacccctgtctcagcaagctctgaggtctcccctgagagccaagaggactcagagaccccagcagaggaggacagtggctctgagcagcctcccaacagcgtcctgcctgacaaactgaaggtgagctgggagaaccccagcccccaggaggcccctgctgcagagagtgcagaaccgtcccaggcaccctgttctgagacttctgaggctgcccccagggagggtgggaagccccctacacccccacccaagatcttatcagagaaactgaaagcctccatgggtgagatgcaggcttctgggccacctgctccaggcacagtgcaggtctcagtgaatggcatggatgacagtcctgagcctgccaagccctctcaggctgagggcaccccaggaactcctccaaaggatgcaacaacatccacagcactgcccccctgggacctgccacctcagttccatccccgctgctcctcccttggggacttgcttggggaaggcccgcggcatcccttgcagcccagggaacggctatatcgggcccagctggaggtgaaggtggcctcggaacagacggagaaactgttgaacaaggtgctgggcagtgagccggcccctgttagtgccgaaacattgctcagccaggctgtggagcagctgaggcaggccacccaggtcctgcaggaaatgagagatttgggagagctgagccaggaagcacctgggctaagggagaagcggaaggagctggtgaccctctacaggagaagtgcaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: