Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF10A-tumor necrosis factor receptor superfamily, member 10a Gene
PTXBC012866
New product
Data sheet of TNFRSF10A-tumor necrosis factor receptor superfamily, member 10a Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF10A-tumor necrosis factor receptor superfamily, member 10a Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012866 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF10A |
| Origin species: | Human |
| Product name: | TNFRSF10A-tumor necrosis factor receptor superfamily, member 10a Gene |
| Size: | 2ug |
| Accessions: | BC012866 |
| Gene id: | 8797 |
| Gene description: | tumor necrosis factor receptor superfamily, member 10a |
| Synonyms: | APO2; CD261; TRAILR-1; TRAILR1; tumor necrosis factor receptor superfamily member 10A; TNF-related apoptosis-inducing ligand receptor 1; TRAIL receptor 1; TRAIL-R1; cytotoxic TRAIL receptor; death receptor 4; tumor necrosis factor receptor superfamily member 10a variant 2; tumor necrosis factor receptor superfamily, member 10a; TNF receptor superfamily member 10a |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgccaccaccagctagagtacatctaggtgcgttcctggcagtgactccgaatcccgggagcgcagcgagtgggacagaggcagccgcggccacacccagcaaagtgtggggctcttccgcggggaggattgaaccacgaggcgggggccgaggagcgctccctacctccatgggacagcacggacccagtgcccgggcccgggcagggcgcgccccaggacccaggccggcgcgggaagccagccctcggctccgggtccacaagaccttcaagtttgtcgtcgtcggggtcctgctgcaggtcgtacctagctcagctgcaaccatcaaacttcatgatcaatcaattggcacacagcaatgggaacatagccctttgggagagttgtgtccaccaggatctcatagatcagaacatcctggagcctgtaaccggtgcacagagggtgtgggttacaccaatgcttccaacaatttgtttgcttgcctcccatgtacagcttgtaaatcagatgaagaagagagaagtccctgcaccacgaccaggaacacagcatgtcagtgcaaaccaggaactttccggaatgacaattctgctgagatgtgccggaagtgcagcagagggtgccccagagggatggtcaaggtcaaggattgtacgccctggagtgacatcgagtgtgtccacaaagaatcaggcaatggacataatatatgggtgattttggttgtgactttggttgttccgttgctgttggtggctgtgctgattgtctgttgttgcatcggctcaggttgtggaggggaccccaagtgcatggacagggtgtgtttctggcgcttgggtctcctacgagggcctggggctgaggacaatgctcacaacgagattctgagcaacgcagactcgctgtccactttcgtctctgagcagcaaatggaaagccaggagccggcagatttgacaggtgtcactgtacagtccccaggggaggcacagtgtctgctgggaccggcagaagctgaagggtctcagaggaggaggctgctggttccagcaaatggtgctgaccccactgagactctgatgctgttctttgacaagtttgcaaacatcgtgccctttgactcctgggaccagctcatgaggcagctggacctcacgaaaaatgagatcgatgtggtcagagctggtacagcaggcccaggggatgccttgtatgcaatgctgatgaaatgggtcaacaaaactggacggaacgcctcgatccacaccctgctggatgccttggagaggatggaagagagacatgcaaaagagaagattcaggacctcttggtggactctggaaagttcatctacttagaagatggcacaggctctgccgtgtccttggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 - oxidative stress induced growth inhibitor family member 2 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 - guanine nucleotide binding protein-like 3 (nucleolar)-like |