Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene
PTXBC001281
New product
Data sheet of TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001281 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF10B |
| Origin species: | Human |
| Product name: | TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene |
| Size: | 2ug |
| Accessions: | BC001281 |
| Gene id: | 8795 |
| Gene description: | tumor necrosis factor receptor superfamily, member 10b |
| Synonyms: | CD262; KILLER; KILLER/DR5; TRAIL-R2; TRAILR2; TRICK2; TRICK2A; TRICK2B; TRICKB; ZTNFR9; tumor necrosis factor receptor superfamily member 10B; Fas-like protein; TNF-related apoptosis-inducing ligand receptor 2; apoptosis inducing protein TRICK2A/2B; apoptosis inducing receptor TRAIL-R2; cytotoxic TRAIL receptor-2; death domain containing receptor for TRAIL/Apo-2L; death receptor 5; p53-regulated DNA damage-inducible cell death receptor(killer); tumor necrosis factor receptor superfamily, member 10b; tumor necrosis factor receptor-like protein ZTNFR9; TNF receptor superfamily member 10b |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacaacggggacagaacgccccggccgcttcgggggcccggaaaaggcacggcccaggacccagggaggcgcggggagccaggcctgggctccgggtccccaagacccttgtgctcgttgtcgccgcggtcctgctgttggtctcagctgagtctgctctgatcacccaacaagacctagctccccagcagagagcggccccacaacaaaagaggtccagcccctcagagggattgtgtccacctggacaccatatctcagaagacggtagagattgcatctcctgcaaatatggacaggactatagcactcactggaatgacctccttttctgcttgcgctgcaccaggtgtgattcaggtgaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggcaccttccgggaagaagattctcctgagatgtgccggaagtgccgcacagggtgtcccagagggatggtcaaggtcggtgattgtacaccctggagtgacatcgaatgtgtccacaaagaatcaggtacaaagcacagtggggaagccccagctgtggaggagacggtgacctccagcccagggactcctgcctctccctgttctctctcaggcatcatcataggagtcacagttgcagccgtagtcttgattgtggctgtgtttgtttgcaagtctttactgtggaagaaagtccttccttacctgaaaggcatctgctcaggtggtggtggggaccctgagcgtgtggacagaagctcacaacgacctggggctgaggacaatgtcctcaatgagatcgtgagtatcttgcagcccacccaggtccctgagcaggaaatggaagtccaggagccagcagagccaacaggtgtcaacatgttgtcccccggggagtcagagcatctgctggaaccggcagaagctgaaaggtctcagaggaggaggctgctggttccagcaaatgaaggtgatcccactgagactctgagacagtgcttcgatgactttgcagacttggtgccctttgactcctgggagccgctcatgaggaagttgggcctcatggacaatgagataaaggtggctaaagctgaggcagcgggccacagggacaccttgtacacgatgctgataaagtgggtcaacaaaaccgggcgagatgcctctgtccacaccctgctggatgccttggagacgctgggagagagacttgccaagcagaagattgaggaccacttgttgagctctggaaagttcatgtatctagaaggtaatgcagactctgccatgtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family O member 2 - tumor necrosis factor receptor superfamily, member 10a - proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 - oxidative stress induced growth inhibitor family member 2 |