TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene View larger

TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001281
Product type: DNA & cDNA
Ncbi symbol: TNFRSF10B
Origin species: Human
Product name: TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene
Size: 2ug
Accessions: BC001281
Gene id: 8795
Gene description: tumor necrosis factor receptor superfamily, member 10b
Synonyms: CD262; KILLER; KILLER/DR5; TRAIL-R2; TRAILR2; TRICK2; TRICK2A; TRICK2B; TRICKB; ZTNFR9; tumor necrosis factor receptor superfamily member 10B; Fas-like protein; TNF-related apoptosis-inducing ligand receptor 2; apoptosis inducing protein TRICK2A/2B; apoptosis inducing receptor TRAIL-R2; cytotoxic TRAIL receptor-2; death domain containing receptor for TRAIL/Apo-2L; death receptor 5; p53-regulated DNA damage-inducible cell death receptor(killer); tumor necrosis factor receptor superfamily, member 10b; tumor necrosis factor receptor-like protein ZTNFR9; TNF receptor superfamily member 10b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacaacggggacagaacgccccggccgcttcgggggcccggaaaaggcacggcccaggacccagggaggcgcggggagccaggcctgggctccgggtccccaagacccttgtgctcgttgtcgccgcggtcctgctgttggtctcagctgagtctgctctgatcacccaacaagacctagctccccagcagagagcggccccacaacaaaagaggtccagcccctcagagggattgtgtccacctggacaccatatctcagaagacggtagagattgcatctcctgcaaatatggacaggactatagcactcactggaatgacctccttttctgcttgcgctgcaccaggtgtgattcaggtgaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggcaccttccgggaagaagattctcctgagatgtgccggaagtgccgcacagggtgtcccagagggatggtcaaggtcggtgattgtacaccctggagtgacatcgaatgtgtccacaaagaatcaggtacaaagcacagtggggaagccccagctgtggaggagacggtgacctccagcccagggactcctgcctctccctgttctctctcaggcatcatcataggagtcacagttgcagccgtagtcttgattgtggctgtgtttgtttgcaagtctttactgtggaagaaagtccttccttacctgaaaggcatctgctcaggtggtggtggggaccctgagcgtgtggacagaagctcacaacgacctggggctgaggacaatgtcctcaatgagatcgtgagtatcttgcagcccacccaggtccctgagcaggaaatggaagtccaggagccagcagagccaacaggtgtcaacatgttgtcccccggggagtcagagcatctgctggaaccggcagaagctgaaaggtctcagaggaggaggctgctggttccagcaaatgaaggtgatcccactgagactctgagacagtgcttcgatgactttgcagacttggtgccctttgactcctgggagccgctcatgaggaagttgggcctcatggacaatgagataaaggtggctaaagctgaggcagcgggccacagggacaccttgtacacgatgctgataaagtgggtcaacaaaaccgggcgagatgcctctgtccacaccctgctggatgccttggagacgctgggagagagacttgccaagcagaagattgaggaccacttgttgagctctggaaagttcatgtatctagaaggtaatgcagactctgccatgtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain containing, family O member 2
- tumor necrosis factor receptor superfamily, member 10a
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
- oxidative stress induced growth inhibitor family member 2

Buy TNFRSF10B-tumor necrosis factor receptor superfamily, member 10b Gene now

Add to cart