Login to display prices
Login to display prices
SERPINI2-serpin peptidase inhibitor, clade I (pancpin), member 2 Gene View larger

SERPINI2-serpin peptidase inhibitor, clade I (pancpin), member 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINI2-serpin peptidase inhibitor, clade I (pancpin), member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINI2-serpin peptidase inhibitor, clade I (pancpin), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027859
Product type: DNA & cDNA
Ncbi symbol: SERPINI2
Origin species: Human
Product name: SERPINI2-serpin peptidase inhibitor, clade I (pancpin), member 2 Gene
Size: 2ug
Accessions: BC027859
Gene id: 5276
Gene description: serpin peptidase inhibitor, clade I (pancpin), member 2
Synonyms: MEPI; PANCPIN; PI14; TSA2004; serpin I2; myoepithelium-derived serine protease inhibitor; pancreas-specific protein TSA2004; peptidase inhibitor 14; protease inhibitor 14; serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2; serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2; serpin peptidase inhibitor, clade I (pancpin), member 2; serpin family I member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacacaatcttcttgtggagtcttctattgctgttttttggaagtcaagcctcaagatgctcagctcaaaaaaataccgaatttgcagtggatctttatcaagaggtttccttatctcataaggacaacattatattttcaccccttggaataactttggttcttgagatggtacaactgggagccaaaggaaaagcacagcagcagataagacaaactttaaaacaacaggaaacctcagctggggaagaattttttgtactgaagtcatttttctctgccatctcagagaaaaaacaagaatttacatttaatcttgccaatgccctctaccttcaagaaggattcactgtgaaagaacagtatctccatggcaacaaggaattttttcagagtgctataaaactggtggattttcaagatgcaaaggcttgtgcagagatgataagtacctgggtagaaagaaaaacagatggaaaaattaaagacatgttttcaggggaagaatttggccctctgactcggcttgtcctggtgaatgctatttatttcaaaggagattggaaacagaaattcagaaaagaggacacacagctgataaattttactaagaaaaatggttcaactgtcaaaattccaatgatgaaggctcttctgagaacaaaatatggttatttttctgaatcttccctgaactaccaagttttagaattgtcttacaaaggtgatgaatttagcttaattatcatacttcctgcagaaggtatggatatagaagaagtggaaaaactaattactgctcaacaaatcctaaaatggctctctgagatgcaagaagaggaagtagaaataagcctccctagatttaaagtagaacaaaaagtagacttcaaagacgttttgtattctttgaacataaccgagatatttagtggtggctgcgacctttctggaataacagattcatctgaagtgtatgtttcccaagtgacgcaaaaagttttctttgagataaatgaagatggtagtgaagctgcaacatcaactggcatacacatccctgtgatcatgagtctggctcaaagccaatttatagcaaatcatccatttctgtttattatgaagcataatccaacagaatcaattctgtttatgggaagagtgacaaatcctgacacccaggagataaaaggaagagatttagattcactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 10b
- pleckstrin homology domain containing, family O member 2
- tumor necrosis factor receptor superfamily, member 10a
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 5