Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD7-proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 Gene
PTXBC012606
New product
Data sheet of PSMD7-proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD7-proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012606 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD7 |
| Origin species: | Human |
| Product name: | PSMD7-proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 Gene |
| Size: | 2ug |
| Accessions: | BC012606 |
| Gene id: | 5713 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
| Synonyms: | MOV34; P40; Rpn8; S12; 26S proteasome non-ATPase regulatory subunit 7; 26S proteasome regulatory subunit S12; 26S proteasome regulatory subunit rpn8; Moloney leukemia virus-34 proviral integration; Mov34 homolog; proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog); proteasome subunit p40; proteasome 26S subunit, non-ATPase 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggagctggcagtgcagaaggtggtggtccaccccctggtgctgctcagtgtggtggatcatttcaaccgaatcggcaaggttggaaaccagaagcgtgttgttggtgtgcttttggggtcatggcaaaagaaagtacttgatgtatcgaacagttttgcagttccttttgatgaagatgacaaagacgattctgtatggtttttagaccatgattatttggaaaacatgtatggaatgtttaagaaagtcaatgccagggaaagaatagttggctggtaccacacaggccctaaactacacaagaatgacattgccatcaacgaactcatgaaaagatactgtcctaattccgtattggtcatcattgatgtgaagccgaaggacctagggctgcctacagaagcgtacatttcagtggaagaagtccatgatgatggaactccaacctcgaaaacatttgaacacgtgaccagtgaaattggagcagaggaagctgaggaagttggagttgaacacttgttacgagatatcaaagacacgacggtgggcactctgtcccagcggatcacaaaccaggtccatggtttgaagggactgaactccaagcttctggatatcaggagctacctggaaaaagtcgccacaggcaagctgcccatcaaccaccagatcatctaccagctgcaggacgtcttcaacctgctgccagatgtcagcctgcaggagttcgtcaaggccttttacctgaagaccaatgaccagatggtggtagtgtacttggcctcgctgatccgttccgtggtcgccctgcacaacctcatcaacaacaagattgccaaccgggatgcagagaagaaagaagggcaggagaaagaagagagcaaaaaggataggaaagaggacaaggagaaagataaagataaggaaaagagtgatgtaaagaaagaggagaaaaaggagaaaaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 - short chain dehydrogenase/reductase family 42E, member 1 - serpin peptidase inhibitor, clade I (pancpin), member 2 - tumor necrosis factor receptor superfamily, member 10b |