DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene View larger

DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002841
Product type: DNA & cDNA
Ncbi symbol: DIMT1L
Origin species: Human
Product name: DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC002841
Gene id: 27292
Gene description: DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
Synonyms: DIMT1L; DIM1; HSA9761; HUSSY5; 18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase; 18S rRNA dimethylase; DIM1 dimethyladenosine transferase 1-like; S-adenosylmethionine-6-N',N'-adenosyl(rRNA) dimethyltransferase; dimethyladenosine transferase; DIM1 dimethyladenosine transferase 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaaggtcaagtcgggggccatcggccgccgccgcgggcggcaggagcagcgccgggagctgaagagcgctggaggactcatgttcaacacggggattgggcagcacattttgaaaaatcctctcattattaacagcattatcgataaggctgccttaagaccaactgatgtagtgctggaagttggacctggaactggcaacatgactgtaaagttgttagaaaaggcaaaaaaggttgttgcttgtgaacttgacccaaggctagtagctgaacttcacaaaagagttcagggcacgcctgtggccagcaaacttcaagtactggtgggtgatgtgctgaaaacagatttgccattctttgatacttgtgtggcaaatttgccttatcagatctcttcgccttttgtcttcaagctgttgctacatcgaccttttttcaggtgtgctatacttatgtttcaaagagaatttgccctccgactggttgcaaaacctggagataagttatactgcagactctcaattaatacacagctgttggcacgtgtggaccatctaatgaaagtgggaaagaataacttcagaccaccgcccaaggtggaatccagtgttgtaaggatagaacctaagaatccaccaccacccatcaattttcaggaatgggatggtctagtaaggataacctttgttaggaaaaacaagacactctctgctgcatttaaatcaagtgcagtgcaacaactcttggaaaaaaactacagaattcactgttcagtccataatattgtcagtgctgctgtgtatcctgtgaaacagatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-ethylmaleimide-sensitive factor attachment protein, alpha
- N-acetylglucosamine-1-phosphate transferase, gamma subunit
- spastic paraplegia 21 (autosomal recessive, Mast syndrome)
- N-ethylmaleimide-sensitive factor attachment protein, gamma

Buy DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene now

Add to cart