Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene
PTXBC029836
New product
Data sheet of PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029836 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMF1 |
| Origin species: | Human |
| Product name: | PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene |
| Size: | 2ug |
| Accessions: | BC029836 |
| Gene id: | 9491 |
| Gene description: | proteasome (prosome, macropain) inhibitor subunit 1 (PI31) |
| Synonyms: | PI31; proteasome inhibitor PI31 subunit; proteasome (prosome, macropain) inhibitor subunit 1 (PI31); proteasome inhibitor subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctaagaagcttgggcccaaatctcagagacagcgtggggctgttgcccccctcacccaggtccagcaggcggcctgttcccccacttataaacaggccaagcgcaatgccaggagctatcagggccgccgccgccgccgtcgttgcagccagaataccacttccagggttcctagccaactgcaagcagttgactcttcatctgcttcctgcaggacctacaagaacagtgaggagcttcggtctcgtattgtgtctggaatcatcacacctatccatgagcagtgggaaaaggctaatgtaagcagtccccaccgggagttcccccctgctaccgccagagaggtggacccactccggattcctccacaccacccacacaccagtcggcagcctccctggtgtgatcccctgggcccgtttgttgtcgggggagaagacttagacccttttgggcctcggagaggtggcatgattgtggatcccctgagatctggcttcccaagagcacttattgacccttcctcaggcctcccgaaccgacttcctccaggcgctgtgcccccaggagctcgctttgacccctttggacccattgggaccagcccacccggacctaacccagaccatctccccccgccgggctacgatgacatgtacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat and sterile alpha motif domain containing 6 - UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) - N-ethylmaleimide-sensitive factor attachment protein, alpha |