PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene View larger

PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029836
Product type: DNA & cDNA
Ncbi symbol: PSMF1
Origin species: Human
Product name: PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene
Size: 2ug
Accessions: BC029836
Gene id: 9491
Gene description: proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Synonyms: PI31; proteasome inhibitor PI31 subunit; proteasome (prosome, macropain) inhibitor subunit 1 (PI31); proteasome inhibitor subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaagaagcttgggcccaaatctcagagacagcgtggggctgttgcccccctcacccaggtccagcaggcggcctgttcccccacttataaacaggccaagcgcaatgccaggagctatcagggccgccgccgccgccgtcgttgcagccagaataccacttccagggttcctagccaactgcaagcagttgactcttcatctgcttcctgcaggacctacaagaacagtgaggagcttcggtctcgtattgtgtctggaatcatcacacctatccatgagcagtgggaaaaggctaatgtaagcagtccccaccgggagttcccccctgctaccgccagagaggtggacccactccggattcctccacaccacccacacaccagtcggcagcctccctggtgtgatcccctgggcccgtttgttgtcgggggagaagacttagacccttttgggcctcggagaggtggcatgattgtggatcccctgagatctggcttcccaagagcacttattgacccttcctcaggcctcccgaaccgacttcctccaggcgctgtgcccccaggagctcgctttgacccctttggacccattgggaccagcccacccggacctaacccagaccatctccccccgccgggctacgatgacatgtacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and sterile alpha motif domain containing 6
- UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
- DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
- N-ethylmaleimide-sensitive factor attachment protein, alpha

Buy PSMF1-proteasome (prosome, macropain) inhibitor subunit 1 (PI31) Gene now

Add to cart