Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene
PTXBC006319
New product
Data sheet of HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006319 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPB7 |
| Origin species: | Human |
| Product name: | HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene |
| Size: | 2ug |
| Accessions: | BC006319 |
| Gene id: | 27129 |
| Gene description: | heat shock 27kDa protein family, member 7 (cardiovascular) |
| Synonyms: | cvHSP; heat shock protein beta-7; cardiovascular heat shock protein; heat shock 27kD protein family, member 7 (cardiovascular); heat shock 27kDa protein family, member 7 (cardiovascular); heat shock protein family B (small) member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccacagaacctcttccaccttccgagcggagagaagtttccattcctcttcttcttcctcctcctcttccacctcctcctcggcctcccgtgccctcccggcccaggacccgcccatggagaaggccctgagcatgttttccgatgactttggcagcttcatgcggccccactcggagcccctggccttcccagcccgccccggtggggcaggcaacatcaagaccctaggagacgcctatgagtttgcggtggacgtgagagacttctcacctgaagacatcattgtcaccacctccaacaaccacatcgaggtgcgggctgagaagctggcggctgacggcaccgtcatgaacaccttcgctcacaagtgccagctgccggaggacgtggacccgacgtcggtgacctcggctctgcgggaggacggcagcctcactatccgggcacggcgtcacccgcatacagaacacgtccagcagaccttccggacggagatcaaaatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin domain containing 12 (endoplasmic reticulum) - asparagine-linked glycosylation 14 homolog (S. cerevisiae) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) - ankyrin repeat and sterile alpha motif domain containing 6 |