HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene View larger

HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene

PTXBC006319

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006319
Product type: DNA & cDNA
Ncbi symbol: HSPB7
Origin species: Human
Product name: HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene
Size: 2ug
Accessions: BC006319
Gene id: 27129
Gene description: heat shock 27kDa protein family, member 7 (cardiovascular)
Synonyms: cvHSP; heat shock protein beta-7; cardiovascular heat shock protein; heat shock 27kD protein family, member 7 (cardiovascular); heat shock 27kDa protein family, member 7 (cardiovascular); heat shock protein family B (small) member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccacagaacctcttccaccttccgagcggagagaagtttccattcctcttcttcttcctcctcctcttccacctcctcctcggcctcccgtgccctcccggcccaggacccgcccatggagaaggccctgagcatgttttccgatgactttggcagcttcatgcggccccactcggagcccctggccttcccagcccgccccggtggggcaggcaacatcaagaccctaggagacgcctatgagtttgcggtggacgtgagagacttctcacctgaagacatcattgtcaccacctccaacaaccacatcgaggtgcgggctgagaagctggcggctgacggcaccgtcatgaacaccttcgctcacaagtgccagctgccggaggacgtggacccgacgtcggtgacctcggctctgcgggaggacggcagcctcactatccgggcacggcgtcacccgcatacagaacacgtccagcagaccttccggacggagatcaaaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 12 (endoplasmic reticulum)
- asparagine-linked glycosylation 14 homolog (S. cerevisiae)
- proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
- ankyrin repeat and sterile alpha motif domain containing 6

Buy HSPB7-heat shock 27kDa protein family, member 7 (cardiovascular) Gene now

Add to cart