Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene
PTXBC008913
New product
Data sheet of TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008913 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TXNDC12 |
| Origin species: | Human |
| Product name: | TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene |
| Size: | 2ug |
| Accessions: | BC008913 |
| Gene id: | 51060 |
| Gene description: | thioredoxin domain containing 12 (endoplasmic reticulum) |
| Synonyms: | AG1; AGR1; ERP16; ERP18; ERP19; PDIA16; TLP19; hAG-1; hTLP19; thioredoxin domain-containing protein 12; ER protein 18; ER protein 19; anterior gradient homolog 1; endoplasmic reticulum protein ERp19; endoplasmic reticulum resident protein 18; endoplasmic reticulum resident protein 19; endoplasmic reticulum thioredoxin superfamily member, 18 kDa; protein disulfide isomerase family A, member 16; thioredoxin domain containing 12 (endoplasmic reticulum); thioredoxin-like protein p19; thioredoxin domain containing 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacgcggcctcgtctcggggccacctgtttgctgggcttcagtttcctgctcctcgtcatctcttctgatggacataatgggcttggaaagggttttggagatcatattcattggaggacactggaagatgggaagaaagaagcagctgccagtggactgcccctgatggtgattattcataaatcctggtgtggagcttgcaaagctctaaagcccaaatttgcagaatctacggaaatttcagaactctcccataattttgttatggtaaatcttgaggatgaagaggaacccaaacatgaagatttcagccctgacgggggttatattccacgaatcctttttctggatcccagtggcaaggtgcatcctgaaatcatcaatgagaatggaaaccccagctacaagtatttttatgtcagtgccgagcaagttgttcaggggatgaaggaagctcaggaaaggctgacgggtgatgccttcagaaagaaacatcttgaagatgaattgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - asparagine-linked glycosylation 14 homolog (S. cerevisiae) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) - ankyrin repeat and sterile alpha motif domain containing 6 - UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) |