Login to display prices
Login to display prices
MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene View larger

MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene

PTXBC017455

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene

Proteogenix catalog: PTXBC017455
Ncbi symbol: MYL6
Product name: MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene
Size: 2ug
Accessions: BC017455
Gene id: 4637
Gene description: myosin, light chain 6, alkali, smooth muscle and non-muscle
Synonyms: ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM; myosin light polypeptide 6; 17 kDa myosin light chain; myosin light chain A3; myosin light chain alkali 3; myosin, light chain 6, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6, alkali, smooth muscle and non-muscle; myosin light chain 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgacttcaccgaagaccagaccgcagagttcaaggaggccttccagctgtttgaccgaacaggtgatggcaagatcctgtacagccagtgtggggatgtgatgagggccctgggccagaaccctaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagatgaatgtgaaggtgctggactttgagcactttctgcccatgctgcagacagtggccaagaacaaggaccagggcacctatgaggattatgtcgaaggacttcgggtgtttgacaaggaaggaaatggcaccgtcatgggtgctgaaatccggcatgttcttgtcacactgggtgagaagatgacagaggaagaagtagagatgctggtggcagggcatgaggacagcaatggttgtatcaactatgaagcgtttgtgaggcatatcctgtcggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice